EMAIL THIS PAGE TO A FRIEND

ATAT1

alpha tubulin acetyltransferase 1

202 Gene Product Result for
Synonyms: C6orf134 MEC17 Nbla00487 TAT
Gene ID:
Mouse(73242) alpha tubulin acetyltransferase 1
Rat(361789) alpha tubulin acetyltransferase 1
Zebrafish(406389) alpha tubulin acetyltransferase 1
dog(477580) alpha tubulin acetyltransferase 1
Horse(100055595) alpha tubulin acetyltransferase 1
cow(786491) alpha tubulin acetyltransferase 1
domestic cat(101093356) alpha tubulin acetyltransferase 1
sheep(101106803) alpha tubulin acetyltransferase 1
domestic guinea pig(100719818) alpha tubulin acetyltransferase 1
naked mole-rat(101705887) alpha tubulin acetyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024909 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028476 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028476 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028476 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031722 Rosetta Predictions human pricing
NM_024909 Rosetta Predictions human pricing
NM_212498 Rosetta Predictions rat pricing
NM_028476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031409 predicted 456
2 SASI_Hs01_00031410 predicted 497
3 SASI_Hs01_00031411 predicted 380
4 SASI_Hs01_00031412 predicted 557
5 SASI_Hs01_00031413 predicted 760
6 SASI_Hs01_00031414 predicted 695
7 SASI_Hs01_00031415 predicted 825
8 SASI_Hs01_00031416 predicted 990
9 SASI_Hs01_00031417 predicted 977
10 SASI_Hs01_00031418 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357513 predicted 221
2 SASI_Hs02_00357514 predicted 258
3 SASI_Hs02_00357515 predicted 1322
4 SASI_Hs02_00357516 predicted 452
5 SASI_Hs01_00177414 predicted 588
6 SASI_Hs01_00177415 predicted 750
7 SASI_Hs01_00177416 predicted 733
8 SASI_Hs02_00357517 predicted 1163
9 SASI_Hs01_00177417 predicted 366
10 SASI_Hs02_00357518 predicted 1301
11 SASI_Hs01_00177409 predicted 421
12 SASI_Hs01_00177410 predicted 221
13 SASI_Hs01_00177411 predicted 312
14 SASI_Hs01_00177412 predicted 281
15 SASI_Hs01_00177413 predicted 344
16 SASI_Hs01_00177418 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050406 predicted 228
2 SASI_Rn02_00270479 predicted 286
3 SASI_Rn01_00050407 predicted 699
4 SASI_Rn01_00050408 predicted 703
5 SASI_Rn01_00050410 predicted 1108
6 SASI_Rn01_00050411 predicted 485
7 SASI_Rn01_00050412 predicted 1148
8 SASI_Rn02_00270480 predicted 604
9 SASI_Rn01_00050413 predicted 216
10 SASI_Rn01_00050414 predicted 458
11 SASI_Rn01_00050409 predicted 675
12 SASI_Rn01_00050415 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063438 predicted 1429
2 SASI_Mm01_00063440 predicted 632
3 SASI_Mm02_00333926 predicted 218
4 SASI_Mm01_00063441 predicted 231
5 SASI_Mm01_00063442 predicted 275
6 SASI_Mm01_00063443 predicted 1049
7 SASI_Mm02_00333927 predicted 545
8 SASI_Mm01_00063444 predicted 297
9 SASI_Mm01_00063445 predicted 1144
10 SASI_Mm01_00063446 predicted 622
11 SASI_Mm01_00063439 predicted 1049
12 SASI_Mm01_00063447 predicted 1307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024909
ATAT1 MISSION shRNA Bacterial Glycerol Stock
alpha tubulin acetyltransferase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024909.2-171s21c1
Sequence:CCGGCAGCAAATTATGACCATTATACTCGAGTATAATGGTCATAATTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024909.2-372s21c1
Sequence:CCGGGATGATCGTGAGGCTCATAATCTCGAGATTATGAGCCTCACGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024909.2-1033s21c1
Sequence:CCGGCTGAGGAGAGTCGATACTAACCTCGAGGTTAGTATCGACTCTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024909.2-458s21c1
Sequence:CCGGGCGAGAACTCTTCCAGTATATCTCGAGATATACTGGAAGAGTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024909.2-1829s21c1
Sequence:CCGGTGGTAGCTAGGTCCCGATATACTCGAGTATATCGGGACCTAGCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024909.1-569s1c1
Sequence:CCGGGAAGGCTTCTTTGCCCATCAACTCGAGTTGATGGGCAAAGAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167971    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024909.1-1192s1c1
Sequence:CCGGCCTGGCTTTAATGTGAGAGTTCTCGAGAACTCTCACATTAAAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024909.1-548s1c1
Sequence:CCGGGTGAACAACTTTGTGATCTTTCTCGAGAAAGATCACAAAGTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024909
ATAT1 MISSION shRNA shRNA Plasmid DNA
alpha tubulin acetyltransferase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024909.2-171s21c1
Sequence:CCGGCAGCAAATTATGACCATTATACTCGAGTATAATGGTCATAATTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024909.2-372s21c1
Sequence:CCGGGATGATCGTGAGGCTCATAATCTCGAGATTATGAGCCTCACGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024909.2-1033s21c1
Sequence:CCGGCTGAGGAGAGTCGATACTAACCTCGAGGTTAGTATCGACTCTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024909.2-458s21c1
Sequence:CCGGGCGAGAACTCTTCCAGTATATCTCGAGATATACTGGAAGAGTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024909.2-1829s21c1
Sequence:CCGGTGGTAGCTAGGTCCCGATATACTCGAGTATATCGGGACCTAGCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024909.1-569s1c1
Sequence:CCGGGAAGGCTTCTTTGCCCATCAACTCGAGTTGATGGGCAAAGAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167971    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024909.1-1192s1c1
Sequence:CCGGCCTGGCTTTAATGTGAGAGTTCTCGAGAACTCTCACATTAAAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024909.1-548s1c1
Sequence:CCGGGTGAACAACTTTGTGATCTTTCTCGAGAAAGATCACAAAGTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024909
ATAT1 MISSION shRNA Lentiviral Transduction Particles
alpha tubulin acetyltransferase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024909.2-171s21c1
Sequence:CCGGCAGCAAATTATGACCATTATACTCGAGTATAATGGTCATAATTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024909.2-372s21c1
Sequence:CCGGGATGATCGTGAGGCTCATAATCTCGAGATTATGAGCCTCACGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024909.2-1033s21c1
Sequence:CCGGCTGAGGAGAGTCGATACTAACCTCGAGGTTAGTATCGACTCTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024909.2-458s21c1
Sequence:CCGGGCGAGAACTCTTCCAGTATATCTCGAGATATACTGGAAGAGTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024909.2-1829s21c1
Sequence:CCGGTGGTAGCTAGGTCCCGATATACTCGAGTATATCGGGACCTAGCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024909.1-569s1c1
Sequence:CCGGGAAGGCTTCTTTGCCCATCAACTCGAGTTGATGGGCAAAGAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167971    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024909.1-1192s1c1
Sequence:CCGGCCTGGCTTTAATGTGAGAGTTCTCGAGAACTCTCACATTAAAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024909.1-548s1c1
Sequence:CCGGGTGAACAACTTTGTGATCTTTCTCGAGAAAGATCACAAAGTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028476
ATAT1 MISSION shRNA Bacterial Glycerol Stock
alpha tubulin acetyltransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028476.2-542s1c1
Sequence:CCGGCCCACAGGTGAACAACTTTGTCTCGAGACAAAGTTGTTCACCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028476.2-506s1c1
Sequence:CCGGGTTCCTGAATAAGCACTACAACTCGAGTTGTAGTGCTTATTCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028476.2-128s1c1
Sequence:CCGGGCAGCAGCAAATCATGACTATCTCGAGATAGTCATGATTTGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028476.2-631s1c1
Sequence:CCGGGAGACATTAAGCCATACTCTTCTCGAGAAGAGTATGGCTTAATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028476.2-549s1c1
Sequence:CCGGGTGAACAACTTTGTCATCTTTCTCGAGAAAGATGACAAAGTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028476
ATAT1 MISSION shRNA shRNA Plasmid DNA
alpha tubulin acetyltransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028476.2-542s1c1
Sequence:CCGGCCCACAGGTGAACAACTTTGTCTCGAGACAAAGTTGTTCACCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028476.2-506s1c1
Sequence:CCGGGTTCCTGAATAAGCACTACAACTCGAGTTGTAGTGCTTATTCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028476.2-128s1c1
Sequence:CCGGGCAGCAGCAAATCATGACTATCTCGAGATAGTCATGATTTGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028476.2-631s1c1
Sequence:CCGGGAGACATTAAGCCATACTCTTCTCGAGAAGAGTATGGCTTAATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028476.2-549s1c1
Sequence:CCGGGTGAACAACTTTGTCATCTTTCTCGAGAAAGATGACAAAGTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028476
ATAT1 MISSION shRNA Lentiviral Transduction Particles
alpha tubulin acetyltransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028476.2-542s1c1
Sequence:CCGGCCCACAGGTGAACAACTTTGTCTCGAGACAAAGTTGTTCACCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028476.2-506s1c1
Sequence:CCGGGTTCCTGAATAAGCACTACAACTCGAGTTGTAGTGCTTATTCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028476.2-128s1c1
Sequence:CCGGGCAGCAGCAAATCATGACTATCTCGAGATAGTCATGATTTGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028476.2-631s1c1
Sequence:CCGGGAGACATTAAGCCATACTCTTCTCGAGAAGAGTATGGCTTAATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028476.2-549s1c1
Sequence:CCGGGTGAACAACTTTGTCATCTTTCTCGAGAAAGATGACAAAGTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks