EMAIL THIS PAGE TO A FRIEND

ATCAY

ataxia, cerebellar, Cayman type

52 Gene Product Result for
Synonyms: BNIP-H CLAC
UniProtKB ID: Q86WG3, Q8NAQ2, Q8TAQ3, Q96HC6, Q96JF5
Gene ID:
Human(85300) Summary: This gene encodes a neuron-restricted protein that contains a CRAL-TRIO motif common to proteins that bind small lipophilic molecules. Mutations in this gene are associated with cerebellar ataxia, Cayman type. [provided by RefSeq, Jul 2008]
Mouse(16467) ataxia, cerebellar, Cayman type homolog (human)
Rat(362826) ataxia, cerebellar, Cayman type
chicken(420094) ataxia, cerebellar, Cayman type
dog(485050) ataxia, cerebellar, Cayman type
domestic cat(101099529) ataxia, cerebellar, Cayman type
cow(509463) ataxia, cerebellar, Cayman type
Horse(100061498) ataxia, cerebellar, Cayman type
naked mole-rat(101705626) ataxia, cerebellar, Cayman type
domestic guinea pig(100729202) ataxia, cerebellar, Cayman type
sheep(101116652) ataxia, cerebellar, Cayman type
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178662 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178662 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178662 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033064 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079231 MISSION® esiRNA esiRNA human ATCAY (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033064 Rosetta Predictions human pricing
NM_001040190 Rosetta Predictions rat pricing
NM_178662 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107260 predicted 1374
2 SASI_Hs01_00107261 predicted 1339
3 SASI_Hs01_00107262 predicted 1505
4 SASI_Hs01_00107263 predicted 932
5 SASI_Hs01_00107264 predicted 943
6 SASI_Hs01_00107265 predicted 767
7 SASI_Hs01_00107267 predicted 1156
8 SASI_Hs02_00360764 predicted 919
9 SASI_Hs01_00107268 predicted 624
10 SASI_Hs01_00107269 predicted 970
11 SASI_Hs01_00107266 predicted 1416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105247 predicted 1221
2 SASI_Rn01_00105248 predicted 809
3 SASI_Rn01_00105249 predicted 1570
4 SASI_Rn01_00105251 predicted 1027
5 SASI_Rn01_00105252 predicted 1829
6 SASI_Rn02_00204912 predicted 483
7 SASI_Rn01_00105254 predicted 668
8 SASI_Rn01_00105255 predicted 1255
9 SASI_Rn01_00105256 predicted 969
10 SASI_Rn02_00204913 predicted 751
11 SASI_Rn01_00105250 predicted 1603
12 SASI_Rn01_00105253 predicted 1637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179487 predicted 1478
2 SASI_Mm01_00179488 predicted 1454
3 SASI_Mm01_00179490 predicted 609
4 SASI_Mm01_00179491 predicted 1432
5 SASI_Mm01_00179492 predicted 675
6 SASI_Mm01_00179493 predicted 948
7 SASI_Mm02_00349117 predicted 675
8 SASI_Mm02_00349118 predicted 1638
9 SASI_Mm02_00349119 predicted 1121
10 SASI_Mm02_00349120 predicted 835
11 SASI_Mm01_00179486 predicted 1090
12 SASI_Mm01_00179489 predicted 1265
13 SASI_Mm01_00179494 predicted 1473
14 SASI_Mm01_00179495 predicted 905
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178662
ATCAY MISSION shRNA Bacterial Glycerol Stock
ataxia, cerebellar, Cayman type
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000184019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178662.2-502s1c1
Sequence:CCGGCGGAGCACATCGAAAGAGAAACTCGAGTTTCTCTTTCGATGTGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178662.2-1087s1c1
Sequence:CCGGGCTGAAGAAGTGTTACCACATCTCGAGATGTGGTAACACTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178662.2-797s1c1
Sequence:CCGGCTGTGGCGAACTGTCATCATACTCGAGTATGATGACAGTTCGCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178662.2-1162s1c1
Sequence:CCGGCTGGTTCATTCGCACTGTGTTCTCGAGAACACAGTGCGAATGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178662
ATCAY MISSION shRNA shRNA Plasmid DNA
ataxia, cerebellar, Cayman type
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000184019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178662.2-502s1c1
Sequence:CCGGCGGAGCACATCGAAAGAGAAACTCGAGTTTCTCTTTCGATGTGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178662.2-1087s1c1
Sequence:CCGGGCTGAAGAAGTGTTACCACATCTCGAGATGTGGTAACACTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178662.2-797s1c1
Sequence:CCGGCTGTGGCGAACTGTCATCATACTCGAGTATGATGACAGTTCGCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178662.2-1162s1c1
Sequence:CCGGCTGGTTCATTCGCACTGTGTTCTCGAGAACACAGTGCGAATGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178662
ATCAY MISSION shRNA Lentiviral Transduction Particles
ataxia, cerebellar, Cayman type
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000184019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178662.2-502s1c1
Sequence:CCGGCGGAGCACATCGAAAGAGAAACTCGAGTTTCTCTTTCGATGTGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178662.2-1087s1c1
Sequence:CCGGGCTGAAGAAGTGTTACCACATCTCGAGATGTGGTAACACTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178662.2-797s1c1
Sequence:CCGGCTGTGGCGAACTGTCATCATACTCGAGTATGATGACAGTTCGCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178662.2-1162s1c1
Sequence:CCGGCTGGTTCATTCGCACTGTGTTCTCGAGAACACAGTGCGAATGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033064
ATCAY MISSION shRNA Bacterial Glycerol Stock
ataxia, cerebellar, Cayman type
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033064.1-2343s1c1
Sequence:CCGGGCTCAGAAACTGGCTCTGAAACTCGAGTTTCAGAGCCAGTTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033064.1-1330s1c1
Sequence:CCGGGTCCTGCAATACGAAGAGGAACTCGAGTTCCTCTTCGTATTGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033064.1-1227s1c1
Sequence:CCGGCCCTTTCATCAGCGTCAAGTTCTCGAGAACTTGACGCTGATGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033064.1-571s1c1
Sequence:CCGGGAGATCAACATTTCTCTGGATCTCGAGATCCAGAGAAATGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033064.1-990s1c1
Sequence:CCGGCTACCACTACATCATGGAGAACTCGAGTTCTCCATGATGTAGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033064
ATCAY MISSION shRNA shRNA Plasmid DNA
ataxia, cerebellar, Cayman type
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033064.1-2343s1c1
Sequence:CCGGGCTCAGAAACTGGCTCTGAAACTCGAGTTTCAGAGCCAGTTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033064.1-1330s1c1
Sequence:CCGGGTCCTGCAATACGAAGAGGAACTCGAGTTCCTCTTCGTATTGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033064.1-1227s1c1
Sequence:CCGGCCCTTTCATCAGCGTCAAGTTCTCGAGAACTTGACGCTGATGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033064.1-571s1c1
Sequence:CCGGGAGATCAACATTTCTCTGGATCTCGAGATCCAGAGAAATGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033064.1-990s1c1
Sequence:CCGGCTACCACTACATCATGGAGAACTCGAGTTCTCCATGATGTAGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033064
ATCAY MISSION shRNA Lentiviral Transduction Particles
ataxia, cerebellar, Cayman type
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033064.1-2343s1c1
Sequence:CCGGGCTCAGAAACTGGCTCTGAAACTCGAGTTTCAGAGCCAGTTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033064.1-1330s1c1
Sequence:CCGGGTCCTGCAATACGAAGAGGAACTCGAGTTCCTCTTCGTATTGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033064.1-1227s1c1
Sequence:CCGGCCCTTTCATCAGCGTCAAGTTCTCGAGAACTTGACGCTGATGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033064.1-571s1c1
Sequence:CCGGGAGATCAACATTTCTCTGGATCTCGAGATCCAGAGAAATGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033064.1-990s1c1
Sequence:CCGGCTACCACTACATCATGGAGAACTCGAGTTCTCCATGATGTAGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks