EMAIL THIS PAGE TO A FRIEND

ATE1

arginyltransferase 1

84 Gene Product Result for
UniProtKB ID: O95260, O95261, Q5SQQ3, Q8WW04
Gene ID:
Human(11101) Summary: This gene encodes an arginyltransferase, an enzyme that is involved in posttranslational conjugation of arginine to N-terminal aspartate or glutamate residues. Conjugation of arginine to the N-terminal aspartate or glutamate targets proteins for ubiquitin-dependent degradation. Alternative splicing results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(11907) arginyltransferase 1
Rat(293526) arginyltransferase 1
Zebrafish(100037311) arginyltransferase 1
cow(534601) arginyltransferase 1
domestic cat(101090722) arginyltransferase 1
dog(486919) arginyltransferase 1
chicken(423936) arginyltransferase 1
Thale Cress(830454) arginine-tRNA protein transferase 1
fruit fly(37288) CG9204 gene product from transcript CG9204-RA
sheep(101110286) arginyltransferase 1
Domestic Rabbit(100338175) arginyltransferase 1
domestic guinea pig(100714356) arginyltransferase 1
naked mole-rat(101706919) arginyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007041 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007041 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007041 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001976 Rosetta Predictions human pricing
NM_007041 Rosetta Predictions human pricing
NM_001106300 Rosetta Predictions rat pricing
NM_001029895 Rosetta Predictions mouse pricing
NM_013799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032369 predicted 1636
2 SASI_Hs01_00032370 predicted 1507
3 SASI_Hs01_00032371 predicted 1334
4 SASI_Hs01_00032372 predicted 618
5 SASI_Hs01_00032373 predicted 1279
6 SASI_Hs01_00032374 predicted 395
7 SASI_Hs01_00032375 predicted 476
8 SASI_Hs01_00032376 predicted 1374
9 SASI_Hs01_00032377 predicted 678
10 SASI_Hs01_00032378 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126534 predicted 1635
2 SASI_Hs01_00126535 predicted 1515
3 SASI_Hs01_00126536 predicted 1337
4 SASI_Hs01_00126537 predicted 625
5 SASI_Hs01_00126538 predicted 1275
6 SASI_Hs01_00126539 predicted 395
7 SASI_Hs01_00126540 predicted 475
8 SASI_Hs01_00126541 predicted 1374
9 SASI_Hs01_00126542 predicted 676
10 SASI_Hs01_00126543 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106300 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217618 predicted 937
2 SASI_Rn02_00217619 predicted 1328
3 SASI_Rn02_00217620 predicted 251
4 SASI_Rn02_00217621 predicted 1283
5 SASI_Rn02_00217622 predicted 230
6 SASI_Rn02_00217623 predicted 1180
7 SASI_Rn02_00217624 predicted 1138
8 SASI_Rn02_00217625 predicted 1130
9 SASI_Rn02_00217626 predicted 1478
10 SASI_Rn02_00217627 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159477 predicted 1084
2 SASI_Mm01_00159479 predicted 832
3 SASI_Mm01_00159480 predicted 1218
4 SASI_Mm01_00159481 predicted 907
5 SASI_Mm01_00159482 predicted 1072
6 SASI_Mm01_00159483 predicted 971
7 SASI_Mm01_00159484 predicted 1120
8 SASI_Mm01_00159485 predicted 1259
9 SASI_Mm02_00288050 predicted 1242
10 SASI_Mm01_00159486 predicted 1174
11 SASI_Mm01_00159478 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154543 predicted 1183
2 SASI_Mm01_00154545 predicted 933
3 SASI_Mm01_00154546 predicted 1315
4 SASI_Mm01_00154547 predicted 1005
5 SASI_Mm01_00154548 predicted 1170
6 SASI_Mm01_00154549 predicted 1070
7 SASI_Mm01_00154550 predicted 1212
8 SASI_Mm01_00154551 predicted 1358
9 SASI_Mm02_00322753 predicted 1344
10 SASI_Mm01_00154552 predicted 1267
11 SASI_Mm01_00154544 predicted 1272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013799
VALIDATED
ATE1 MISSION shRNA Bacterial Glycerol Stock
arginyltransferase 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013799.2-3977s1c1
Sequence:CCGGCGGCTGATTCTGTCAGTGATTCTCGAGAATCACTGACAGAATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013799.2-1507s1c1
Sequence:CCGGGCCATGCCTTACGGTGTTTATCTCGAGATAAACACCGTAAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013799.2-940s1c1
Sequence:CCGGGAGTCTTACCAGGTCTATAAACTCGAGTTTATAGACCTGGTAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013799.2-463s1c1
Sequence:CCGGGCATTAATTAACAAGCTGGATCTCGAGATCCAGCTTGTTAATTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013799.2-1010s1c1
Sequence:CCGGGCCAGTTTACAAGATTCCTTTCTCGAGAAAGGAATCTTGTAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013799.2-939s21c1
Sequence:CCGGGGAGTCTTACCAGGTCTATAACTCGAGTTATAGACCTGGTAAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1506s21c1
Sequence:CCGGTGCCATGCCTTACGGTGTTTACTCGAGTAAACACCGTAAGGCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1265s21c1
Sequence:CCGGCATCGCAACTCAGCTATTATTCTCGAGAATAATAGCTGAGTTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1758s21c1
Sequence:CCGGATGAGAATCTTGTGGTTAATACTCGAGTATTAACCACAAGATTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-212s21c1
Sequence:CCGGAGGATTATCAGGATCTTATAGCTCGAGCTATAAGATCCTGATAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1106s21c1
Sequence:CCGGGGCTCGATGGGAAGATCATTGCTCGAGCAATGATCTTCCCATCGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1175s21c1
Sequence:CCGGTCTACTACGATCCTGATTATTCTCGAGAATAATCAGGATCGTAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1317s21c1
Sequence:CCGGGATGAGATACAAGGGTCAATACTCGAGTATTGACCCTTGTATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013799
VALIDATED
ATE1 MISSION shRNA shRNA Plasmid DNA
arginyltransferase 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013799.2-3977s1c1
Sequence:CCGGCGGCTGATTCTGTCAGTGATTCTCGAGAATCACTGACAGAATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013799.2-1507s1c1
Sequence:CCGGGCCATGCCTTACGGTGTTTATCTCGAGATAAACACCGTAAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013799.2-940s1c1
Sequence:CCGGGAGTCTTACCAGGTCTATAAACTCGAGTTTATAGACCTGGTAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013799.2-463s1c1
Sequence:CCGGGCATTAATTAACAAGCTGGATCTCGAGATCCAGCTTGTTAATTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013799.2-1010s1c1
Sequence:CCGGGCCAGTTTACAAGATTCCTTTCTCGAGAAAGGAATCTTGTAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013799.2-939s21c1
Sequence:CCGGGGAGTCTTACCAGGTCTATAACTCGAGTTATAGACCTGGTAAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1506s21c1
Sequence:CCGGTGCCATGCCTTACGGTGTTTACTCGAGTAAACACCGTAAGGCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1265s21c1
Sequence:CCGGCATCGCAACTCAGCTATTATTCTCGAGAATAATAGCTGAGTTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1758s21c1
Sequence:CCGGATGAGAATCTTGTGGTTAATACTCGAGTATTAACCACAAGATTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-212s21c1
Sequence:CCGGAGGATTATCAGGATCTTATAGCTCGAGCTATAAGATCCTGATAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1106s21c1
Sequence:CCGGGGCTCGATGGGAAGATCATTGCTCGAGCAATGATCTTCCCATCGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1175s21c1
Sequence:CCGGTCTACTACGATCCTGATTATTCTCGAGAATAATCAGGATCGTAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1317s21c1
Sequence:CCGGGATGAGATACAAGGGTCAATACTCGAGTATTGACCCTTGTATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013799
VALIDATED
ATE1 MISSION shRNA Lentiviral Transduction Particles
arginyltransferase 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013799.2-3977s1c1
Sequence:CCGGCGGCTGATTCTGTCAGTGATTCTCGAGAATCACTGACAGAATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013799.2-1507s1c1
Sequence:CCGGGCCATGCCTTACGGTGTTTATCTCGAGATAAACACCGTAAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013799.2-940s1c1
Sequence:CCGGGAGTCTTACCAGGTCTATAAACTCGAGTTTATAGACCTGGTAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013799.2-463s1c1
Sequence:CCGGGCATTAATTAACAAGCTGGATCTCGAGATCCAGCTTGTTAATTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013799.2-1010s1c1
Sequence:CCGGGCCAGTTTACAAGATTCCTTTCTCGAGAAAGGAATCTTGTAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013799.2-939s21c1
Sequence:CCGGGGAGTCTTACCAGGTCTATAACTCGAGTTATAGACCTGGTAAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1506s21c1
Sequence:CCGGTGCCATGCCTTACGGTGTTTACTCGAGTAAACACCGTAAGGCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1265s21c1
Sequence:CCGGCATCGCAACTCAGCTATTATTCTCGAGAATAATAGCTGAGTTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1758s21c1
Sequence:CCGGATGAGAATCTTGTGGTTAATACTCGAGTATTAACCACAAGATTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-212s21c1
Sequence:CCGGAGGATTATCAGGATCTTATAGCTCGAGCTATAAGATCCTGATAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1106s21c1
Sequence:CCGGGGCTCGATGGGAAGATCATTGCTCGAGCAATGATCTTCCCATCGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1175s21c1
Sequence:CCGGTCTACTACGATCCTGATTATTCTCGAGAATAATCAGGATCGTAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013799.2-1317s21c1
Sequence:CCGGGATGAGATACAAGGGTCAATACTCGAGTATTGACCCTTGTATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007041
VALIDATED
ATE1 MISSION shRNA Bacterial Glycerol Stock
arginyltransferase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007041.1-461s1c1
Sequence:CCGGCGGGTGACTTTGCATTGATAACTCGAGTTATCAATGCAAAGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007041.1-1346s1c1
Sequence:CCGGGTCAGTATAGACCTTCTGATTCTCGAGAATCAGAAGGTCTATACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007041.1-1375s1c1
Sequence:CCGGCCTGAGACATATGTTTGGGTACTCGAGTACCCAAACATATGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007041.1-520s1c1
Sequence:CCGGGATGACATCAAAGAGAGTTTACTCGAGTAAACTCTCTTTGATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007041.1-312s1c1
Sequence:CCGGCACAATAAGGTGCCGACCTTTCTCGAGAAAGGTCGGCACCTTATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007041.2-484s21c1
Sequence:CCGGGGATATACAGTGTGATCTTAACTCGAGTTAAGATCACACTGTATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007041.2-1185s21c1
Sequence:CCGGTGTACTACGATCCTGATTATTCTCGAGAATAATCAGGATCGTAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007041.2-1516s21c1
Sequence:CCGGCATCATGCCTTACGGTGTTTACTCGAGTAAACACCGTAAGGCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007041
VALIDATED
ATE1 MISSION shRNA shRNA Plasmid DNA
arginyltransferase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007041.1-461s1c1
Sequence:CCGGCGGGTGACTTTGCATTGATAACTCGAGTTATCAATGCAAAGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007041.1-1346s1c1
Sequence:CCGGGTCAGTATAGACCTTCTGATTCTCGAGAATCAGAAGGTCTATACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007041.1-1375s1c1
Sequence:CCGGCCTGAGACATATGTTTGGGTACTCGAGTACCCAAACATATGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007041.1-520s1c1
Sequence:CCGGGATGACATCAAAGAGAGTTTACTCGAGTAAACTCTCTTTGATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007041.1-312s1c1
Sequence:CCGGCACAATAAGGTGCCGACCTTTCTCGAGAAAGGTCGGCACCTTATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007041.2-484s21c1
Sequence:CCGGGGATATACAGTGTGATCTTAACTCGAGTTAAGATCACACTGTATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007041.2-1185s21c1
Sequence:CCGGTGTACTACGATCCTGATTATTCTCGAGAATAATCAGGATCGTAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007041.2-1516s21c1
Sequence:CCGGCATCATGCCTTACGGTGTTTACTCGAGTAAACACCGTAAGGCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007041
VALIDATED
ATE1 MISSION shRNA Lentiviral Transduction Particles
arginyltransferase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007041.1-461s1c1
Sequence:CCGGCGGGTGACTTTGCATTGATAACTCGAGTTATCAATGCAAAGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007041.1-1346s1c1
Sequence:CCGGGTCAGTATAGACCTTCTGATTCTCGAGAATCAGAAGGTCTATACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007041.1-1375s1c1
Sequence:CCGGCCTGAGACATATGTTTGGGTACTCGAGTACCCAAACATATGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007041.1-520s1c1
Sequence:CCGGGATGACATCAAAGAGAGTTTACTCGAGTAAACTCTCTTTGATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007041.1-312s1c1
Sequence:CCGGCACAATAAGGTGCCGACCTTTCTCGAGAAAGGTCGGCACCTTATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007041.2-484s21c1
Sequence:CCGGGGATATACAGTGTGATCTTAACTCGAGTTAAGATCACACTGTATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007041.2-1185s21c1
Sequence:CCGGTGTACTACGATCCTGATTATTCTCGAGAATAATCAGGATCGTAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007041.2-1516s21c1
Sequence:CCGGCATCATGCCTTACGGTGTTTACTCGAGTAAACACCGTAAGGCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks