EMAIL THIS PAGE TO A FRIEND

ATF1

activating transcription factor 1

73 Gene Product Result for
Synonyms: EWS-ATF1 FUS/ATF-1 TREB36
UniProtKB ID: P18846, P25168, Q9H4A8
Gene ID:
Human(466) Summary: This gene encodes an activating transcription factor, which belongs to the ATF subfamily and bZIP (basic-region leucine zipper) family. It influences cellular physiologic processes by regulating the expression of downstream target genes, which are related to growth, survival, and other cellular activities. This protein is phosphorylated at serine 63 in its kinase-inducible domain by serine/threonine kinases, cAMP-dependent protein kinase A, calmodulin-dependent protein kinase I/II, mitogen- and stress-activated protein kinase and cyclin-dependent kinase 3 (cdk-3). Its phosphorylation enhances its transactivation and transcriptional activities, and enhances cell transformation. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in angiomatoid fibrous histiocytoma and clear cell sarcoma. This gene has a pseudogene on chromosome 6. [provided by RefSeq, Aug 2010]
Mouse(11908) activating transcription factor 1
Rat(315305) activating transcription factor 1
Zebrafish(325609) activating transcription factor 1
cow(506967) activating transcription factor 1
domestic cat(101088253) activating transcription factor 1
dog(486545) activating transcription factor 1
chicken(426873) activating transcription factor 1
naked mole-rat(101726719) activating transcription factor 1
domestic guinea pig(100719533) activating transcription factor 1
sheep(101117917) activating transcription factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A7833 Anti-ATF-1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
microarray, western blot pricing
AV38573 Anti-ATF1 (AB1) antibody produced in rabbit affinity isolated antibody sheep, canine, rat, bovine, human, mouse, guinea pig, horse, rabbit
western blot pricing
AV31366 Anti-ATF1 (AB2) antibody produced in rabbit affinity isolated antibody rat, canine, zebrafish, mouse, guinea pig, human, rabbit, bovine, horse
western blot pricing
AV38574 Anti-ATF1 (AB3) antibody produced in rabbit affinity isolated antibody pig, rabbit, horse, bovine, mouse, guinea pig, human, zebrafish, rat, sheep
western blot pricing
HPA055069 Anti-ATF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4501950 Anti-ATF1 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing
HPA055406 Anti-ATF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4501951 Anti-ATF1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB4503857 Anti-phospho-ATF1 (pSer63) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4301413 Anti-phospho-ATF1 (pSer63) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
WH0000466M1 Monoclonal Anti-ATF1 antibody produced in mouse clone 6G10, ascites fluid human
ELISA, western blot pricing
SAB1403581 Monoclonal Anti-ATF1 antibody produced in mouse clone 3E7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007497 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007497 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007497 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005171 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005171 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005171 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005171 siRNAs that have been validated in the lab human pricing
XM_001064437 Rosetta Predictions rat pricing
XM_235657 Rosetta Predictions rat pricing
NM_007497 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005171 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093707 validated 669
2 SASI_Hs01_00093704 predicted 961
3 SASI_Hs01_00093705 predicted 738
4 SASI_Hs01_00093706 predicted 796
5 SASI_Hs01_00093708 predicted 363
6 SASI_Hs01_00093709 predicted 716
7 SASI_Hs01_00093710 predicted 658
8 SASI_Hs01_00093711 predicted 835
9 SASI_Hs01_00093712 predicted 780
10 SASI_Hs01_00093713 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310491 predicted 1121
2 SASI_Rn02_00310492 predicted 354
3 SASI_Rn02_00310493 predicted 401
4 SASI_Rn02_00310494 predicted 834
5 SASI_Rn02_00310495 predicted 1080
6 SASI_Rn02_00310496 predicted 565
7 SASI_Rn02_00310497 predicted 372
8 SASI_Rn02_00310498 predicted 897
9 SASI_Rn02_00310499 predicted 515
10 SASI_Rn02_00310500 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389566 predicted 1081
2 SASI_Rn02_00389567 predicted 308
3 SASI_Rn02_00389568 predicted 365
4 SASI_Rn02_00389569 predicted 795
5 SASI_Rn02_00389570 predicted 1040
6 SASI_Rn02_00389571 predicted 530
7 SASI_Rn02_00389572 predicted 324
8 SASI_Rn02_00389573 predicted 856
9 SASI_Rn02_00389574 predicted 474
10 SASI_Rn02_00389575 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311769 predicted 256
2 SASI_Mm01_00049026 predicted 902
3 SASI_Mm01_00049027 predicted 1006
4 SASI_Mm01_00049028 predicted 688
5 SASI_Mm01_00049029 predicted 695
6 SASI_Mm01_00049030 predicted 769
7 SASI_Mm01_00049031 predicted 1001
8 SASI_Mm01_00049032 predicted 638
9 SASI_Mm01_00049033 predicted 675
10 SASI_Mm01_00049034 predicted 717
11 SASI_Mm01_00049035 predicted 601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007497
ATF1 MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007497.3-1247s21c1
Sequence:CCGGATGGACTTTCAGCAGTTTAAACTCGAGTTTAAACTGCTGAAAGTCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007497.3-1524s21c1
Sequence:CCGGTCGTAATGTCAGGTATGTTAACTCGAGTTAACATACCTGACATTACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007497.3-1003s21c1
Sequence:CCGGAGACTTTGAAGGACCTTTATTCTCGAGAATAAAGGTCCTTCAAAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007497.3-370s21c1
Sequence:CCGGGCATAGGCTCCTCACAGAAAGCTCGAGCTTTCTGTGAGGAGCCTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007497.3-1481s21c1
Sequence:CCGGCATAAAGCGTTACTAAGTATGCTCGAGCATACTTAGTAACGCTTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007497.2-1349s1c1
Sequence:CCGGGCCTCATTTCTGCCAATAAATCTCGAGATTTATTGGCAGAAATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007497.2-243s1c1
Sequence:CCGGCCTCACGTTTCTCAGATAGTACTCGAGTACTATCTGAGAAACGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007497.2-577s1c1
Sequence:CCGGCCATGACAAATTCAAGCAGTACTCGAGTACTGCTTGAATTTGTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007497.2-803s1c1
Sequence:CCGGCCCTCAACTAAGAAGAGAAATCTCGAGATTTCTCTTCTTAGTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007497.2-566s1c1
Sequence:CCGGGCAGACATTAACCATGACAAACTCGAGTTTGTCATGGTTAATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007497
ATF1 MISSION shRNA shRNA Plasmid DNA
activating transcription factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007497.3-1247s21c1
Sequence:CCGGATGGACTTTCAGCAGTTTAAACTCGAGTTTAAACTGCTGAAAGTCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007497.3-1524s21c1
Sequence:CCGGTCGTAATGTCAGGTATGTTAACTCGAGTTAACATACCTGACATTACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007497.3-1003s21c1
Sequence:CCGGAGACTTTGAAGGACCTTTATTCTCGAGAATAAAGGTCCTTCAAAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007497.3-370s21c1
Sequence:CCGGGCATAGGCTCCTCACAGAAAGCTCGAGCTTTCTGTGAGGAGCCTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007497.3-1481s21c1
Sequence:CCGGCATAAAGCGTTACTAAGTATGCTCGAGCATACTTAGTAACGCTTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007497.2-1349s1c1
Sequence:CCGGGCCTCATTTCTGCCAATAAATCTCGAGATTTATTGGCAGAAATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007497.2-243s1c1
Sequence:CCGGCCTCACGTTTCTCAGATAGTACTCGAGTACTATCTGAGAAACGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007497.2-577s1c1
Sequence:CCGGCCATGACAAATTCAAGCAGTACTCGAGTACTGCTTGAATTTGTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007497.2-803s1c1
Sequence:CCGGCCCTCAACTAAGAAGAGAAATCTCGAGATTTCTCTTCTTAGTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007497.2-566s1c1
Sequence:CCGGGCAGACATTAACCATGACAAACTCGAGTTTGTCATGGTTAATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007497
ATF1 MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007497.3-1247s21c1
Sequence:CCGGATGGACTTTCAGCAGTTTAAACTCGAGTTTAAACTGCTGAAAGTCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007497.3-1524s21c1
Sequence:CCGGTCGTAATGTCAGGTATGTTAACTCGAGTTAACATACCTGACATTACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007497.3-1003s21c1
Sequence:CCGGAGACTTTGAAGGACCTTTATTCTCGAGAATAAAGGTCCTTCAAAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007497.3-370s21c1
Sequence:CCGGGCATAGGCTCCTCACAGAAAGCTCGAGCTTTCTGTGAGGAGCCTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007497.3-1481s21c1
Sequence:CCGGCATAAAGCGTTACTAAGTATGCTCGAGCATACTTAGTAACGCTTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007497.2-1349s1c1
Sequence:CCGGGCCTCATTTCTGCCAATAAATCTCGAGATTTATTGGCAGAAATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007497.2-243s1c1
Sequence:CCGGCCTCACGTTTCTCAGATAGTACTCGAGTACTATCTGAGAAACGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007497.2-577s1c1
Sequence:CCGGCCATGACAAATTCAAGCAGTACTCGAGTACTGCTTGAATTTGTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007497.2-803s1c1
Sequence:CCGGCCCTCAACTAAGAAGAGAAATCTCGAGATTTCTCTTCTTAGTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007497.2-566s1c1
Sequence:CCGGGCAGACATTAACCATGACAAACTCGAGTTTGTCATGGTTAATGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005171
VALIDATED
ATF1 MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005171.3-1438s21c1
Sequence:CCGGCCTACAGGTTTGCATTTGTTTCTCGAGAAACAAATGCAAACCTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005171.3-1063s21c1
Sequence:CCGGTGAAGGATCTTTATTCCAATACTCGAGTATTGGAATAAAGATCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005171.3-335s21c1
Sequence:CCGGAGTTCAGGGAGCTCACATTTCCTCGAGGAAATGTGAGCTCCCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005171.3-418s21c1
Sequence:CCGGGCATAGGCTCCTCACAGAAAGCTCGAGCTTTCTGTGAGGAGCCTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_005171.3-835s21c1
Sequence:CCGGCAGCTACTTCTCTGCCACAAACTCGAGTTTGTGGCAGAGAAGTAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005171.2-1396s1c1
Sequence:CCGGCCTACAGGTTTGCATTTGTTTCTCGAGAAACAAATGCAAACCTGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_005171.2-793s1c1
Sequence:CCGGCAGCTACTTCTCTGCCACAAACTCGAGTTTGTGGCAGAGAAGTAGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005171.2-723s1c1
Sequence:CCGGCCCAGCAATCAGGTGGTCGTACTCGAGTACGACCACCTGATTGCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005171.2-321s1c1
Sequence:CCGGGCTCAACAGGTATCATCTTTACTCGAGTAAAGATGATACCTGTTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005171.2-668s1c1
Sequence:CCGGAGGTACAACTATTCTTCAGTACTCGAGTACTGAAGAATAGTTGTACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005171
VALIDATED
ATF1 MISSION shRNA shRNA Plasmid DNA
activating transcription factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005171.3-1438s21c1
Sequence:CCGGCCTACAGGTTTGCATTTGTTTCTCGAGAAACAAATGCAAACCTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005171.3-1063s21c1
Sequence:CCGGTGAAGGATCTTTATTCCAATACTCGAGTATTGGAATAAAGATCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005171.3-335s21c1
Sequence:CCGGAGTTCAGGGAGCTCACATTTCCTCGAGGAAATGTGAGCTCCCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005171.3-418s21c1
Sequence:CCGGGCATAGGCTCCTCACAGAAAGCTCGAGCTTTCTGTGAGGAGCCTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_005171.3-835s21c1
Sequence:CCGGCAGCTACTTCTCTGCCACAAACTCGAGTTTGTGGCAGAGAAGTAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005171.2-1396s1c1
Sequence:CCGGCCTACAGGTTTGCATTTGTTTCTCGAGAAACAAATGCAAACCTGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_005171.2-793s1c1
Sequence:CCGGCAGCTACTTCTCTGCCACAAACTCGAGTTTGTGGCAGAGAAGTAGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005171.2-723s1c1
Sequence:CCGGCCCAGCAATCAGGTGGTCGTACTCGAGTACGACCACCTGATTGCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005171.2-321s1c1
Sequence:CCGGGCTCAACAGGTATCATCTTTACTCGAGTAAAGATGATACCTGTTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005171.2-668s1c1
Sequence:CCGGAGGTACAACTATTCTTCAGTACTCGAGTACTGAAGAATAGTTGTACCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005171
VALIDATED
ATF1 MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005171.3-1438s21c1
Sequence:CCGGCCTACAGGTTTGCATTTGTTTCTCGAGAAACAAATGCAAACCTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005171.3-1063s21c1
Sequence:CCGGTGAAGGATCTTTATTCCAATACTCGAGTATTGGAATAAAGATCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005171.3-335s21c1
Sequence:CCGGAGTTCAGGGAGCTCACATTTCCTCGAGGAAATGTGAGCTCCCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005171.3-418s21c1
Sequence:CCGGGCATAGGCTCCTCACAGAAAGCTCGAGCTTTCTGTGAGGAGCCTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_005171.3-835s21c1
Sequence:CCGGCAGCTACTTCTCTGCCACAAACTCGAGTTTGTGGCAGAGAAGTAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005171.2-1396s1c1
Sequence:CCGGCCTACAGGTTTGCATTTGTTTCTCGAGAAACAAATGCAAACCTGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_005171.2-793s1c1
Sequence:CCGGCAGCTACTTCTCTGCCACAAACTCGAGTTTGTGGCAGAGAAGTAGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005171.2-723s1c1
Sequence:CCGGCCCAGCAATCAGGTGGTCGTACTCGAGTACGACCACCTGATTGCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005171.2-321s1c1
Sequence:CCGGGCTCAACAGGTATCATCTTTACTCGAGTAAAGATGATACCTGTTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005171.2-668s1c1
Sequence:CCGGAGGTACAACTATTCTTCAGTACTCGAGTACTGAAGAATAGTTGTACCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)