EMAIL THIS PAGE TO A FRIEND

ATF3

activating transcription factor 3

235 Gene Product Result for
UniProtKB ID: P18847, Q5VTZ2, Q6ICQ9, Q7Z566, Q8WYM6
Gene ID:
Human(467) Summary: This gene encodes a member of the mammalian activation transcription factor/cAMP responsive element-binding (CREB) protein family of transcription factors. This gene is induced by a variety of signals, including many of those encountered by cancer cells, and is involved in the complex process of cellular stress response. Multiple transcript variants encoding different isoforms have been found for this gene. It is possible that alternative splicing of this gene may be physiologically important in the regulation of target genes. [provided by RefSeq, Apr 2011]
Mouse(11910) activating transcription factor 3
Rat(25389) activating transcription factor 3
naked mole-rat(101713965) activating transcription factor 3
domestic guinea pig(100722370) activating transcription factor 3
sheep(101116073) activating transcription factor 3
Zebrafish(393939) activating transcription factor 3
cow(515266) activating transcription factor 3
domestic cat(101099925) activating transcription factor 3
dog(612911) activating transcription factor 3
fruit fly(43867) Activating transcription factor 3
chicken(421369) activating transcription factor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412010 ANTI-ATF3 antibody produced in mouse clone 6G11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412328 ANTI-ATF3 antibody produced in mouse clone 8D8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412644 ANTI-ATF3 antibody produced in mouse clone 7G10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2108283 Anti-ATF3 antibody produced in rabbit affinity isolated antibody bovine, human, canine, mouse, rabbit, yeast, rat, horse, guinea pig
western blot pricing
HPA001562 Anti-ATF3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103491 Anti-ATF3 antibody produced in rabbit affinity isolated antibody, lyophilized powder canine, rat, mouse, horse, yeast, bovine, human, chicken, rabbit
western blot pricing
SAB1410817 Anti-ATF3 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4501953 Anti-ATF3, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
WH0000467M4 Monoclonal Anti-ATF3 antibody produced in mouse clone 8G5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
AMAB90909 Monoclonal Anti-ATF3 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1685, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1403582 Monoclonal Anti-ATF3 antibody produced in mouse clone 6B8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007498 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007498 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007498 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001674 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001674 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001674 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001030287 Rosetta Predictions human pricing
NM_001040619 Rosetta Predictions human pricing
NM_001674 Rosetta Predictions human pricing
NM_004024 Rosetta Predictions human pricing
NM_012912 Rosetta Predictions rat pricing
NM_007498 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099068 predicted 703
2 SASI_Hs01_00247596 predicted 1150
3 SASI_Hs01_00099069 predicted 1000
4 SASI_Hs01_00247603 predicted 919
5 SASI_Hs01_00099070 predicted 742
6 SASI_Hs01_00247604 predicted 851
7 SASI_Hs01_00099071 predicted 896
8 SASI_Hs01_00099073 predicted 1091
9 SASI_Hs01_00099074 predicted 906
10 SASI_Hs01_00099075 predicted 849
11 SASI_Hs01_00099067 predicted 1167
12 SASI_Hs01_00247602 predicted 965
13 SASI_Hs01_00099072 predicted 1097
14 SASI_Hs01_00099076 predicted 1002
15 SASI_Hs01_00247581 predicted 952
16 SASI_Hs01_00247582 predicted 760
17 SASI_Hs01_00247583 predicted 1021
18 SASI_Hs01_00247584 predicted 868
19 SASI_Hs01_00247585 predicted 1007
20 SASI_Hs01_00247586 predicted 954
21 SASI_Hs01_00247587 predicted 887
22 SASI_Hs01_00247588 predicted 1145
23 SASI_Hs01_00247589 predicted 876
24 SASI_Hs01_00247590 predicted 748
25 SASI_Hs01_00247591 predicted 593
26 SASI_Hs01_00247592 predicted 549
27 SASI_Hs01_00247593 predicted 502
28 SASI_Hs01_00247594 predicted 634
29 SASI_Hs01_00247595 predicted 660
30 SASI_Hs01_00247597 predicted 670
31 SASI_Hs01_00247598 predicted 429
32 SASI_Hs01_00247599 predicted 577
33 SASI_Hs01_00247600 predicted 668
34 SASI_Hs01_00247601 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068147 predicted 1049
2 SASI_Hs01_00068148 predicted 1010
3 SASI_Hs01_00068149 predicted 956
4 SASI_Hs01_00068150 predicted 663
5 SASI_Hs01_00068151 predicted 1087
6 SASI_Hs01_00068153 predicted 1129
7 SASI_Hs01_00068154 predicted 1097
8 SASI_Hs01_00068155 predicted 1032
9 SASI_Hs01_00068156 predicted 1121
10 SASI_Hs02_00309013 predicted 622
11 SASI_Hs01_00068152 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065471 predicted 852
2 SASI_Hs02_00332310 predicted 1302
3 SASI_Hs01_00065472 predicted 1154
4 SASI_Hs02_00332311 predicted 1061
5 SASI_Hs01_00065473 predicted 892
6 SASI_Hs02_00332312 predicted 1006
7 SASI_Hs01_00065474 predicted 1046
8 SASI_Hs01_00065476 predicted 1246
9 SASI_Hs01_00065477 predicted 1053
10 SASI_Hs01_00065478 predicted 1000
11 SASI_Hs01_00065470 predicted 1318
12 SASI_Hs01_00065475 predicted 1243
13 SASI_Hs01_00065479 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142571 predicted 952
2 SASI_Hs01_00142572 predicted 922
3 SASI_Hs01_00142573 predicted 868
4 SASI_Hs01_00142574 predicted 657
5 SASI_Hs01_00142575 predicted 1003
6 SASI_Hs01_00142577 predicted 1040
7 SASI_Hs01_00142578 predicted 1000
8 SASI_Hs02_00336773 predicted 580
9 SASI_Hs01_00142579 predicted 942
10 SASI_Hs01_00142580 predicted 1027
11 SASI_Hs01_00142576 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012912 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046734 predicted 458
2 SASI_Rn01_00046735 predicted 1204
3 SASI_Rn01_00046736 predicted 1094
4 SASI_Rn01_00046737 predicted 1129
5 SASI_Rn01_00046738 predicted 610
6 SASI_Rn01_00046739 predicted 1161
7 SASI_Rn01_00046740 predicted 289
8 SASI_Rn01_00046741 predicted 731
9 SASI_Rn01_00046742 predicted 1008
10 SASI_Rn01_00046743 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311770 predicted 611
2 SASI_Mm01_00132055 predicted 661
3 SASI_Mm01_00132056 predicted 1181
4 SASI_Mm02_00311771 predicted 1161
5 SASI_Mm01_00132057 predicted 983
6 SASI_Mm01_00132058 predicted 744
7 SASI_Mm01_00132059 predicted 772
8 SASI_Mm02_00311772 predicted 1279
9 SASI_Mm02_00311773 predicted 1253
10 SASI_Mm01_00132060 predicted 487
11 SASI_Mm01_00132052 predicted 708
12 SASI_Mm01_00132053 predicted 1107
13 SASI_Mm01_00132054 predicted 1266
14 SASI_Mm01_00132061 predicted 1004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007498
VALIDATED
ATF3 MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007498.3-393s21c1
Sequence:CCGGCAGAATAAACACCTCTGCCATCTCGAGATGGCAGAGGTGTTTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007498.3-770s21c1
Sequence:CCGGAGAAGGAACATTGCAGAGCTACTCGAGTAGCTCTGCAATGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007498.3-989s21c1
Sequence:CCGGGCATCCTTTGTCTCACCAATTCTCGAGAATTGGTGAGACAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007498.3-542s21c1
Sequence:CCGGTGCTGCCAAGTGTCGAAACAACTCGAGTTGTTTCGACACTTGGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007498.2-1000s1c1
Sequence:CCGGGCATCCTTTGTCTCACCAATTCTCGAGAATTGGTGAGACAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007498.2-781s1c1
Sequence:CCGGAGAAGGAACATTGCAGAGCTACTCGAGTAGCTCTGCAATGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007498.2-404s1c1
Sequence:CCGGCAGAATAAACACCTCTGCCATCTCGAGATGGCAGAGGTGTTTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007498.2-553s1c1
Sequence:CCGGTGCTGCCAAGTGTCGAAACAACTCGAGTTGTTTCGACACTTGGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007498.2-759s1c1
Sequence:CCGGACCTCTTTATCCAACAGATAACTCGAGTTATCTGTTGGATAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007498
VALIDATED
ATF3 MISSION shRNA shRNA Plasmid DNA
activating transcription factor 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007498.3-393s21c1
Sequence:CCGGCAGAATAAACACCTCTGCCATCTCGAGATGGCAGAGGTGTTTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007498.3-770s21c1
Sequence:CCGGAGAAGGAACATTGCAGAGCTACTCGAGTAGCTCTGCAATGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007498.3-989s21c1
Sequence:CCGGGCATCCTTTGTCTCACCAATTCTCGAGAATTGGTGAGACAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007498.3-542s21c1
Sequence:CCGGTGCTGCCAAGTGTCGAAACAACTCGAGTTGTTTCGACACTTGGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007498.2-1000s1c1
Sequence:CCGGGCATCCTTTGTCTCACCAATTCTCGAGAATTGGTGAGACAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007498.2-781s1c1
Sequence:CCGGAGAAGGAACATTGCAGAGCTACTCGAGTAGCTCTGCAATGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007498.2-404s1c1
Sequence:CCGGCAGAATAAACACCTCTGCCATCTCGAGATGGCAGAGGTGTTTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007498.2-553s1c1
Sequence:CCGGTGCTGCCAAGTGTCGAAACAACTCGAGTTGTTTCGACACTTGGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007498.2-759s1c1
Sequence:CCGGACCTCTTTATCCAACAGATAACTCGAGTTATCTGTTGGATAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007498
VALIDATED
ATF3 MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007498.3-393s21c1
Sequence:CCGGCAGAATAAACACCTCTGCCATCTCGAGATGGCAGAGGTGTTTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007498.3-770s21c1
Sequence:CCGGAGAAGGAACATTGCAGAGCTACTCGAGTAGCTCTGCAATGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007498.3-989s21c1
Sequence:CCGGGCATCCTTTGTCTCACCAATTCTCGAGAATTGGTGAGACAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007498.3-542s21c1
Sequence:CCGGTGCTGCCAAGTGTCGAAACAACTCGAGTTGTTTCGACACTTGGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007498.2-1000s1c1
Sequence:CCGGGCATCCTTTGTCTCACCAATTCTCGAGAATTGGTGAGACAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007498.2-781s1c1
Sequence:CCGGAGAAGGAACATTGCAGAGCTACTCGAGTAGCTCTGCAATGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007498.2-404s1c1
Sequence:CCGGCAGAATAAACACCTCTGCCATCTCGAGATGGCAGAGGTGTTTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007498.2-553s1c1
Sequence:CCGGTGCTGCCAAGTGTCGAAACAACTCGAGTTGTTTCGACACTTGGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007498.2-759s1c1
Sequence:CCGGACCTCTTTATCCAACAGATAACTCGAGTTATCTGTTGGATAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001674
VALIDATED
ATF3 MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001674.2-775s21c1
Sequence:CCGGAGATGAGAGAAACCTCTTTATCTCGAGATAAAGAGGTTTCTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001674.2-725s21c1
Sequence:CCGGCTTCATCGGCCCACGTGTATTCTCGAGAATACACGTGGGCCGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001674.2-1287s21c1
Sequence:CCGGGTTGTGCTTTCTAGCAAATATCTCGAGATATTTGCTAGAAAGCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001674.2-693s21c1
Sequence:CCGGACGAGAAGCAGCATTTGATATCTCGAGATATCAAATGCTGCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001674.2-659s21c1
Sequence:CCGGGCTGAACTGAAGGCTCAGATTCTCGAGAATCTGAGCCTTCAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001674.1-993s1c1
Sequence:CCGGCCGCCTTTCATCTGGATTCTACTCGAGTAGAATCCAGATGAAAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001674.1-584s1c1
Sequence:CCGGGCATTTGATATACATGCTCAACTCGAGTTGAGCATGTATATCAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001674.1-411s1c1
Sequence:CCGGCCTGAAGAAGATGAAAGGAAACTCGAGTTTCCTTTCATCTTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001674.1-540s1c1
Sequence:CCGGGCTGAACTGAAGGCTCAGATTCTCGAGAATCTGAGCCTTCAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001674.1-668s1c1
Sequence:CCGGCCTCTTTATCCAACAGATAAACTCGAGTTTATCTGTTGGATAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001674
VALIDATED
ATF3 MISSION shRNA shRNA Plasmid DNA
activating transcription factor 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001674.2-775s21c1
Sequence:CCGGAGATGAGAGAAACCTCTTTATCTCGAGATAAAGAGGTTTCTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001674.2-725s21c1
Sequence:CCGGCTTCATCGGCCCACGTGTATTCTCGAGAATACACGTGGGCCGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001674.2-1287s21c1
Sequence:CCGGGTTGTGCTTTCTAGCAAATATCTCGAGATATTTGCTAGAAAGCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001674.2-693s21c1
Sequence:CCGGACGAGAAGCAGCATTTGATATCTCGAGATATCAAATGCTGCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001674.2-659s21c1
Sequence:CCGGGCTGAACTGAAGGCTCAGATTCTCGAGAATCTGAGCCTTCAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001674.1-993s1c1
Sequence:CCGGCCGCCTTTCATCTGGATTCTACTCGAGTAGAATCCAGATGAAAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001674.1-584s1c1
Sequence:CCGGGCATTTGATATACATGCTCAACTCGAGTTGAGCATGTATATCAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001674.1-411s1c1
Sequence:CCGGCCTGAAGAAGATGAAAGGAAACTCGAGTTTCCTTTCATCTTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001674.1-540s1c1
Sequence:CCGGGCTGAACTGAAGGCTCAGATTCTCGAGAATCTGAGCCTTCAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001674.1-668s1c1
Sequence:CCGGCCTCTTTATCCAACAGATAAACTCGAGTTTATCTGTTGGATAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001674
VALIDATED
ATF3 MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001674.2-775s21c1
Sequence:CCGGAGATGAGAGAAACCTCTTTATCTCGAGATAAAGAGGTTTCTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001674.2-725s21c1
Sequence:CCGGCTTCATCGGCCCACGTGTATTCTCGAGAATACACGTGGGCCGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001674.2-1287s21c1
Sequence:CCGGGTTGTGCTTTCTAGCAAATATCTCGAGATATTTGCTAGAAAGCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001674.2-693s21c1
Sequence:CCGGACGAGAAGCAGCATTTGATATCTCGAGATATCAAATGCTGCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001674.2-659s21c1
Sequence:CCGGGCTGAACTGAAGGCTCAGATTCTCGAGAATCTGAGCCTTCAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001674.1-993s1c1
Sequence:CCGGCCGCCTTTCATCTGGATTCTACTCGAGTAGAATCCAGATGAAAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001674.1-584s1c1
Sequence:CCGGGCATTTGATATACATGCTCAACTCGAGTTGAGCATGTATATCAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001674.1-411s1c1
Sequence:CCGGCCTGAAGAAGATGAAAGGAAACTCGAGTTTCCTTTCATCTTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001674.1-540s1c1
Sequence:CCGGGCTGAACTGAAGGCTCAGATTCTCGAGAATCTGAGCCTTCAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001674.1-668s1c1
Sequence:CCGGCCTCTTTATCCAACAGATAAACTCGAGTTTATCTGTTGGATAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks