EMAIL THIS PAGE TO A FRIEND

ATF4

activating transcription factor 4

102 Gene Product Result for
Synonyms: CREB-2 CREB2 TAXREB67 TXREB
UniProtKB ID: P18848, Q9UH31
Gene ID:
Human(468) Summary: This gene encodes a transcription factor that was originally identified as a widely expressed mammalian DNA binding protein that could bind a tax-responsive enhancer element in the LTR of HTLV-1. The encoded protein was also isolated and characterized as the cAMP-response element binding protein 2 (CREB-2). The protein encoded by this gene belongs to a family of DNA-binding proteins that includes the AP-1 family of transcription factors, cAMP-response element binding proteins (CREBs) and CREB-like proteins. These transcription factors share a leucine zipper region that is involved in protein-protein interactions, located C-terminal to a stretch of basic amino acids that functions as a DNA binding domain. Two alternative transcripts encoding the same protein have been described. Two pseudogenes are located on the X chromosome at q28 in a region containing a large inverted duplication. [provided by RefSeq, Sep 2011]
Mouse(11911) activating transcription factor 4
Rat(79255) activating transcription factor 4
chicken(395693) activating transcription factor 4 (tax-responsive enhancer element B67)
dog(474503) activating transcription factor 4 (tax-responsive enhancer element B67)
cow(509107) activating transcription factor 4 (tax-responsive enhancer element B67)
domestic cat(101084297) activating transcription factor 4 (tax-responsive enhancer element B67)
sheep(100216465) activating transcription factor 4 (tax-responsive enhancer element B67)
domestic guinea pig(100732296) activating transcription factor 4
naked mole-rat(101724287) activating transcription factor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108508 Anti-ATF4 affinity isolated antibody mouse
immunohistochemistry, western blot pricing
AV37017 Anti-ATF4 (AB1) antibody produced in rabbit affinity isolated antibody mouse
western blot pricing
AV38067 Anti-ATF4 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, mouse, rat, guinea pig, canine, pig, horse, human
western blot pricing
SAB2501899 Anti-ATF4 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, pig, human, rat
ELISA, western blot pricing
SAB2500130 Anti-ATF4 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB2108090 Anti-ATF4 antibody produced in rabbit affinity isolated antibody human, mouse, rat, pig
western blot pricing
SAB2100168 Anti-ATF4 antibody produced in rabbit affinity isolated antibody, lyophilized powder pig, rat, human, mouse
western blot pricing
SAB2105294 Anti-ATF4, (C-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, mouse, horse
western blot pricing
SAB4301388 Anti-phospho-ATF-4 (pSer219) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300041 Anti-phospho-ATF4 (pSer245) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4504343 Anti-phospho-ATF4 (pSer245) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing
SAB5201221 Monoclonal Anti-Atf4 - Alkaline Phosphatase antibody produced in mouse clone S360A-24, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201222 Monoclonal Anti-Atf4 - Apc antibody produced in mouse clone S360A-24, purified immunoglobulin rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201213 Monoclonal Anti-Atf4 - Atto 390 antibody produced in mouse clone S360A-24, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201214 Monoclonal Anti-Atf4 - Atto 488 antibody produced in mouse clone S360A-24, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201215 Monoclonal Anti-Atf4 - Atto 565 antibody produced in mouse clone S360A-24, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201216 Monoclonal Anti-Atf4 - Atto 594 antibody produced in mouse clone S360A-24, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201217 Monoclonal Anti-Atf4 - Atto 633 antibody produced in mouse clone S360A-24, purified immunoglobulin rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201218 Monoclonal Anti-Atf4 - Atto 655 antibody produced in mouse clone S360A-24, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201219 Monoclonal Anti-Atf4 - Atto 680 antibody produced in mouse clone S360A-24, purified immunoglobulin rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201220 Monoclonal Anti-Atf4 - Atto 700 antibody produced in mouse clone S360A-24, purified immunoglobulin rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201223 Monoclonal Anti-Atf4 - Biotin antibody produced in mouse clone S360A-24, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201224 Monoclonal Anti-Atf4 - Fitc antibody produced in mouse clone S360A-24, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201225 Monoclonal Anti-Atf4 - Hrp antibody produced in mouse clone S360A-24, purified immunoglobulin rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201226 Monoclonal Anti-Atf4 - Pe/Atto 594 antibody produced in mouse clone S360A-24, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201227 Monoclonal Anti-Atf4 - Percp antibody produced in mouse clone S360A-24, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201228 Monoclonal Anti-Atf4 - Rpe antibody produced in mouse clone S360A-24, purified immunoglobulin rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201229 Monoclonal Anti-Atf4 - Streptavidin antibody produced in mouse clone S360A-24, purified immunoglobulin rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201212 Monoclonal Anti-Atf4 antibody produced in mouse clone S360A-24, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
WH0000468M1 Monoclonal Anti-ATF4 antibody produced in mouse clone 2B3, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB1403583 Monoclonal Anti-ATF4 antibody produced in mouse clone 2E3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009716 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009716 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009716 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001675 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001675 Rosetta Predictions human pricing
NM_182810 Rosetta Predictions human pricing
NM_024403 Rosetta Predictions rat pricing
NM_009716 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332313 predicted 1104
2 SASI_Hs02_00332314 predicted 1790
3 SASI_Hs01_00175197 predicted 1448
4 SASI_Hs02_00332315 predicted 1791
5 SASI_Hs01_00175203 predicted 1450
6 SASI_Hs02_00332316 predicted 1965
7 SASI_Hs01_00175196 predicted 1304
8 SASI_Hs01_00175198 predicted 1427
9 SASI_Hs01_00175199 predicted 1180
10 SASI_Hs01_00175200 predicted 1104
11 SASI_Hs01_00175201 predicted 1002
12 SASI_Hs01_00175202 predicted 1222
13 SASI_Hs01_00175204 predicted 1294
14 SASI_Hs01_00175205 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370952 predicted 503
2 SASI_Hs02_00370953 predicted 1183
3 SASI_Hs01_00117299 predicted 848
4 SASI_Hs02_00370954 predicted 1189
5 SASI_Hs01_00117305 predicted 847
6 SASI_Hs02_00370955 predicted 1361
7 SASI_Hs01_00117298 predicted 704
8 SASI_Hs01_00117300 predicted 825
9 SASI_Hs01_00117301 predicted 568
10 SASI_Hs01_00117302 predicted 508
11 SASI_Hs01_00117303 predicted 399
12 SASI_Hs01_00117304 predicted 619
13 SASI_Hs01_00117306 predicted 695
14 SASI_Hs01_00117307 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103280 predicted 796
2 SASI_Rn01_00103281 predicted 677
3 SASI_Rn01_00103282 predicted 434
4 SASI_Rn01_00103283 predicted 551
5 SASI_Rn01_00103284 predicted 314
6 SASI_Rn01_00103286 predicted 896
7 SASI_Rn01_00103287 predicted 678
8 SASI_Rn01_00103288 predicted 945
9 SASI_Rn01_00103289 predicted 377
10 SASI_Rn02_00264002 predicted 216
11 SASI_Rn01_00103285 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316863 predicted 1459
2 SASI_Mm02_00316864 predicted 595
3 SASI_Mm02_00316865 predicted 988
4 SASI_Mm01_00128579 predicted 869
5 SASI_Mm02_00316866 predicted 938
6 SASI_Mm02_00316867 predicted 930
7 SASI_Mm02_00316868 predicted 761
8 SASI_Mm02_00316869 predicted 1454
9 SASI_Mm01_00128581 predicted 1003
10 SASI_Mm02_00316870 predicted 925
11 SASI_Mm01_00128578 predicted 876
12 SASI_Mm01_00128580 predicted 866
13 SASI_Mm01_00128582 predicted 1060
14 SASI_Mm01_00128583 predicted 1073
15 SASI_Mm01_00128584 predicted 516
16 SASI_Mm01_00128585 predicted 815
17 SASI_Mm01_00128586 predicted 618
18 SASI_Mm01_00128587 predicted 222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009716
VALIDATED
ATF4 MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009716.1-1188s1c1
Sequence:CCGGGCGAGTGTAAGGAGCTAGAAACTCGAGTTTCTAGCTCCTTACACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009716.1-362s1c1
Sequence:CCGGCTAGGTCTCTTAGATGACTATCTCGAGATAGTCATCTAAGAGACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009716.1-216s1c1
Sequence:CCGGCGGACAAAGATACCTTCGAGTCTCGAGACTCGAAGGTATCTTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009716.1-641s1c1
Sequence:CCGGCCTCTAGTCCAAGAGACTAATCTCGAGATTAGTCTCTTGGACTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009716.1-788s1c1
Sequence:CCGGCCAGAGCATTCCTTTAGTTTACTCGAGTAAACTAAAGGAATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009716.2-1182s21c1
Sequence:CCGGTGCTGCTTACATTACTCTAATCTCGAGATTAGAGTAATGTAAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009716.2-685s21c1
Sequence:CCGGCTAGGTCTCTTAGATGACTATCTCGAGATAGTCATCTAAGAGACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009716.2-1111s21c1
Sequence:CCGGCCAGAGCATTCCTTTAGTTTACTCGAGTAAACTAAAGGAATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301721    
Product Details
Validated
Region:5UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009716.2-538s21c1
Sequence:CCGGCGGACAAAGATACCTTCGAGTCTCGAGACTCGAAGGTATCTTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009716.2-1375s21c1
Sequence:CCGGGACCCACCTGGAGTTAGTTTGCTCGAGCAAACTAACTCCAGGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009716
VALIDATED
ATF4 MISSION shRNA shRNA Plasmid DNA
activating transcription factor 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009716.1-1188s1c1
Sequence:CCGGGCGAGTGTAAGGAGCTAGAAACTCGAGTTTCTAGCTCCTTACACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009716.1-362s1c1
Sequence:CCGGCTAGGTCTCTTAGATGACTATCTCGAGATAGTCATCTAAGAGACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009716.1-216s1c1
Sequence:CCGGCGGACAAAGATACCTTCGAGTCTCGAGACTCGAAGGTATCTTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009716.1-641s1c1
Sequence:CCGGCCTCTAGTCCAAGAGACTAATCTCGAGATTAGTCTCTTGGACTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009716.1-788s1c1
Sequence:CCGGCCAGAGCATTCCTTTAGTTTACTCGAGTAAACTAAAGGAATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009716.2-1182s21c1
Sequence:CCGGTGCTGCTTACATTACTCTAATCTCGAGATTAGAGTAATGTAAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009716.2-685s21c1
Sequence:CCGGCTAGGTCTCTTAGATGACTATCTCGAGATAGTCATCTAAGAGACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009716.2-1111s21c1
Sequence:CCGGCCAGAGCATTCCTTTAGTTTACTCGAGTAAACTAAAGGAATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301721    
Product Details
Validated
Region:5UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009716.2-538s21c1
Sequence:CCGGCGGACAAAGATACCTTCGAGTCTCGAGACTCGAAGGTATCTTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009716.2-1375s21c1
Sequence:CCGGGACCCACCTGGAGTTAGTTTGCTCGAGCAAACTAACTCCAGGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009716
VALIDATED
ATF4 MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009716.1-1188s1c1
Sequence:CCGGGCGAGTGTAAGGAGCTAGAAACTCGAGTTTCTAGCTCCTTACACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009716.1-362s1c1
Sequence:CCGGCTAGGTCTCTTAGATGACTATCTCGAGATAGTCATCTAAGAGACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009716.1-216s1c1
Sequence:CCGGCGGACAAAGATACCTTCGAGTCTCGAGACTCGAAGGTATCTTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009716.1-641s1c1
Sequence:CCGGCCTCTAGTCCAAGAGACTAATCTCGAGATTAGTCTCTTGGACTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009716.1-788s1c1
Sequence:CCGGCCAGAGCATTCCTTTAGTTTACTCGAGTAAACTAAAGGAATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009716.2-1182s21c1
Sequence:CCGGTGCTGCTTACATTACTCTAATCTCGAGATTAGAGTAATGTAAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009716.2-685s21c1
Sequence:CCGGCTAGGTCTCTTAGATGACTATCTCGAGATAGTCATCTAAGAGACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009716.2-1111s21c1
Sequence:CCGGCCAGAGCATTCCTTTAGTTTACTCGAGTAAACTAAAGGAATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301721    
Product Details
Validated
Region:5UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009716.2-538s21c1
Sequence:CCGGCGGACAAAGATACCTTCGAGTCTCGAGACTCGAAGGTATCTTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009716.2-1375s21c1
Sequence:CCGGGACCCACCTGGAGTTAGTTTGCTCGAGCAAACTAACTCCAGGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001675
VALIDATED
ATF4 MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_001675.2-971s1c1
Sequence:CCGGGCCTAGGTCTCTTAGATGATTCTCGAGAATCATCTAAGAGACCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001675.2-1397s1c1
Sequence:CCGGCCACTCCAGATCATTCCTTTACTCGAGTAAAGGAATGATCTGGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_001675.2-1003s1c1
Sequence:CCGGGCCAAGCACTTCAAACCTCATCTCGAGATGAGGTTTGAAGTGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001675.2-1495s1c1
Sequence:CCGGCCTCAGTGCATAAAGGAGGAACTCGAGTTCCTCCTTTATGCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001675.2-1392s21c1
Sequence:CCGGGTCCTCCACTCCAGATCATTCCTCGAGGAATGATCTGGAGTGGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001675.2-1169s21c1
Sequence:CCGGTGGATGCCCTGTTGGGTATAGCTCGAGCTATACCCAACAGGGCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001675.2-1214s21c1
Sequence:CCGGACCTTCTGACCACGTTGGATGCTCGAGCATCCAACGTGGTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001675.2-1488s21c1
Sequence:CCGGCATGATCCCTCAGTGCATAAACTCGAGTTTATGCACTGAGGGATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001675.2-972s21c1
Sequence:CCGGCCTAGGTCTCTTAGATGATTACTCGAGTAATCATCTAAGAGACCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001675
VALIDATED
ATF4 MISSION shRNA shRNA Plasmid DNA
activating transcription factor 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_001675.2-971s1c1
Sequence:CCGGGCCTAGGTCTCTTAGATGATTCTCGAGAATCATCTAAGAGACCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001675.2-1397s1c1
Sequence:CCGGCCACTCCAGATCATTCCTTTACTCGAGTAAAGGAATGATCTGGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_001675.2-1003s1c1
Sequence:CCGGGCCAAGCACTTCAAACCTCATCTCGAGATGAGGTTTGAAGTGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001675.2-1495s1c1
Sequence:CCGGCCTCAGTGCATAAAGGAGGAACTCGAGTTCCTCCTTTATGCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001675.2-1392s21c1
Sequence:CCGGGTCCTCCACTCCAGATCATTCCTCGAGGAATGATCTGGAGTGGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001675.2-1169s21c1
Sequence:CCGGTGGATGCCCTGTTGGGTATAGCTCGAGCTATACCCAACAGGGCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001675.2-1214s21c1
Sequence:CCGGACCTTCTGACCACGTTGGATGCTCGAGCATCCAACGTGGTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001675.2-1488s21c1
Sequence:CCGGCATGATCCCTCAGTGCATAAACTCGAGTTTATGCACTGAGGGATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001675.2-972s21c1
Sequence:CCGGCCTAGGTCTCTTAGATGATTACTCGAGTAATCATCTAAGAGACCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001675
VALIDATED
ATF4 MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_001675.2-971s1c1
Sequence:CCGGGCCTAGGTCTCTTAGATGATTCTCGAGAATCATCTAAGAGACCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001675.2-1397s1c1
Sequence:CCGGCCACTCCAGATCATTCCTTTACTCGAGTAAAGGAATGATCTGGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_001675.2-1003s1c1
Sequence:CCGGGCCAAGCACTTCAAACCTCATCTCGAGATGAGGTTTGAAGTGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001675.2-1495s1c1
Sequence:CCGGCCTCAGTGCATAAAGGAGGAACTCGAGTTCCTCCTTTATGCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001675.2-1392s21c1
Sequence:CCGGGTCCTCCACTCCAGATCATTCCTCGAGGAATGATCTGGAGTGGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001675.2-1169s21c1
Sequence:CCGGTGGATGCCCTGTTGGGTATAGCTCGAGCTATACCCAACAGGGCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001675.2-1214s21c1
Sequence:CCGGACCTTCTGACCACGTTGGATGCTCGAGCATCCAACGTGGTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001675.2-1488s21c1
Sequence:CCGGCATGATCCCTCAGTGCATAAACTCGAGTTTATGCACTGAGGGATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001675.2-972s21c1
Sequence:CCGGCCTAGGTCTCTTAGATGATTACTCGAGTAATCATCTAAGAGACCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks