EMAIL THIS PAGE TO A FRIEND

ATF6

activating transcription factor 6

Synonyms: ATF6A
UniProtKB ID: P18850, O15139, Q5VW62, Q6IPB5, Q9UEC9
Gene ID:
Human(22926) Summary: This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
Mouse(226641) activating transcription factor 6
Rat(304962) activating transcription factor 6
Zebrafish(558071) activating transcription factor 6
cow(530610) activating transcription factor 6
Horse(100051169) activating transcription factor 6
domestic cat(101086780) activating transcription factor 6
dog(488660) activating transcription factor 6
chicken(424365) activating transcription factor 6
fruit fly(35480) CG3136 gene product from transcript CG3136-RA
sheep(541606) activating transcription factor 6
Domestic Rabbit(100358536) activating transcription factor 6
domestic guinea pig(100730337) activating transcription factor 6
naked mole-rat(101706597) activating transcription factor 6
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007348 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_129579 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_129579 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_129579 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001081304 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081304 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081304 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007348 Rosetta Predictions human pricing
NM_001107196 Rosetta Predictions rat pricing
NM_001081304 Rosetta Predictions mouse pricing
XM_888686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343439 predicted 1840
2 SASI_Hs01_00220477 predicted 1896
3 SASI_Hs01_00220478 predicted 1986
4 SASI_Hs01_00220479 predicted 670
5 SASI_Hs02_00343440 predicted 1966
6 SASI_Hs01_00220480 predicted 743
7 SASI_Hs01_00220481 predicted 1242
8 SASI_Hs01_00220482 predicted 1021
9 SASI_Hs01_00220485 predicted 1323
10 SASI_Hs01_00220486 predicted 1546
11 SASI_Hs01_00220483 predicted 428
12 SASI_Hs01_00220484 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226455 predicted 703
2 SASI_Rn02_00226456 predicted 1390
3 SASI_Rn02_00226457 predicted 958
4 SASI_Rn02_00226458 predicted 894
5 SASI_Rn02_00226459 predicted 623
6 SASI_Rn02_00226460 predicted 513
7 SASI_Rn02_00226461 predicted 1371
8 SASI_Rn02_00226462 predicted 1504
9 SASI_Rn02_00226463 predicted 1859
10 SASI_Rn02_00226464 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297131 predicted 1831
2 SASI_Mm02_00297132 predicted 886
3 SASI_Mm02_00297133 predicted 965
4 SASI_Mm02_00297134 predicted 1934
5 SASI_Mm02_00297135 predicted 1435
6 SASI_Mm02_00297136 predicted 1372
7 SASI_Mm02_00297137 predicted 422
8 SASI_Mm02_00297138 predicted 919
9 SASI_Mm02_00297139 predicted 1857
10 SASI_Mm02_00297140 predicted 1390
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206640 predicted 1836
2 SASI_Mm01_00206641 predicted 891
3 SASI_Mm01_00206642 predicted 964
4 SASI_Mm01_00206643 predicted 1937
5 SASI_Mm01_00206644 predicted 1437
6 SASI_Mm01_00206645 predicted 1383
7 SASI_Mm01_00206646 predicted 428
8 SASI_Mm01_00206647 predicted 919
9 SASI_Mm01_00206648 predicted 1857
10 SASI_Mm01_00206649 predicted 1396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007348
VALIDATED
ATF6 MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 6
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_007348.1-1687s1c1
Sequence:CCGGCCCAGAAGTTATCAAGACTTTCTCGAGAAAGTCTTGATAACTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_007348.1-332s1c1
Sequence:CCGGCCTCAAGTTATTCAGTCTCATCTCGAGATGAGACTGAATAACTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007348.1-1784s1c1
Sequence:CCGGCCACCCATAACAAGACCACAACTCGAGTTGTGGTCTTGTTATGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_007348.1-690s1c1
Sequence:CCGGGCAGCAACCAATTATCAGTTTCTCGAGAAACTGATAATTGGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-1210s21c1
Sequence:CCGGGATGATAGTATTGGCATTTATCTCGAGATAAATGCCAATACTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007348.2-2175s21c1
Sequence:CCGGAGAACTGTCTCGTACTAGAATCTCGAGATTCTAGTACGAGACAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007348.2-2278s21c1
Sequence:CCGGGATGCAAGAGAACAATGTTTCCTCGAGGAAACATTGTTCTCTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-1842s21c1
Sequence:CCGGCAATTGTGTTACCAGCAATAACTCGAGTTATTGCTGGTAACACAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-1487s21c1
Sequence:CCGGACAGAGTCTCTCAGGTTAAATCTCGAGATTTAACCTGAGAGACTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-1349s21c1
Sequence:CCGGGACACATCAGATGGTATTATCCTCGAGGATAATACCATCTGATGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-683s21c1
Sequence:CCGGCAGACAGTACCAACGCTTATGCTCGAGCATAAGCGTTGGTACTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-1158s21c1
Sequence:CCGGCAGAGAACCAGAGGCTTAAAGCTCGAGCTTTAAGCCTCTGGTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007348
VALIDATED
ATF6 MISSION shRNA shRNA Plasmid DNA
activating transcription factor 6
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_007348.1-1687s1c1
Sequence:CCGGCCCAGAAGTTATCAAGACTTTCTCGAGAAAGTCTTGATAACTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_007348.1-332s1c1
Sequence:CCGGCCTCAAGTTATTCAGTCTCATCTCGAGATGAGACTGAATAACTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007348.1-1784s1c1
Sequence:CCGGCCACCCATAACAAGACCACAACTCGAGTTGTGGTCTTGTTATGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_007348.1-690s1c1
Sequence:CCGGGCAGCAACCAATTATCAGTTTCTCGAGAAACTGATAATTGGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-1210s21c1
Sequence:CCGGGATGATAGTATTGGCATTTATCTCGAGATAAATGCCAATACTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007348.2-2175s21c1
Sequence:CCGGAGAACTGTCTCGTACTAGAATCTCGAGATTCTAGTACGAGACAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007348.2-2278s21c1
Sequence:CCGGGATGCAAGAGAACAATGTTTCCTCGAGGAAACATTGTTCTCTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-1842s21c1
Sequence:CCGGCAATTGTGTTACCAGCAATAACTCGAGTTATTGCTGGTAACACAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-1487s21c1
Sequence:CCGGACAGAGTCTCTCAGGTTAAATCTCGAGATTTAACCTGAGAGACTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-1349s21c1
Sequence:CCGGGACACATCAGATGGTATTATCCTCGAGGATAATACCATCTGATGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-683s21c1
Sequence:CCGGCAGACAGTACCAACGCTTATGCTCGAGCATAAGCGTTGGTACTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-1158s21c1
Sequence:CCGGCAGAGAACCAGAGGCTTAAAGCTCGAGCTTTAAGCCTCTGGTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007348
VALIDATED
ATF6 MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 6
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_007348.1-1687s1c1
Sequence:CCGGCCCAGAAGTTATCAAGACTTTCTCGAGAAAGTCTTGATAACTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_007348.1-332s1c1
Sequence:CCGGCCTCAAGTTATTCAGTCTCATCTCGAGATGAGACTGAATAACTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007348.1-1784s1c1
Sequence:CCGGCCACCCATAACAAGACCACAACTCGAGTTGTGGTCTTGTTATGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_007348.1-690s1c1
Sequence:CCGGGCAGCAACCAATTATCAGTTTCTCGAGAAACTGATAATTGGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-1210s21c1
Sequence:CCGGGATGATAGTATTGGCATTTATCTCGAGATAAATGCCAATACTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007348.2-2175s21c1
Sequence:CCGGAGAACTGTCTCGTACTAGAATCTCGAGATTCTAGTACGAGACAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007348.2-2278s21c1
Sequence:CCGGGATGCAAGAGAACAATGTTTCCTCGAGGAAACATTGTTCTCTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-1842s21c1
Sequence:CCGGCAATTGTGTTACCAGCAATAACTCGAGTTATTGCTGGTAACACAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-1487s21c1
Sequence:CCGGACAGAGTCTCTCAGGTTAAATCTCGAGATTTAACCTGAGAGACTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-1349s21c1
Sequence:CCGGGACACATCAGATGGTATTATCCTCGAGGATAATACCATCTGATGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-683s21c1
Sequence:CCGGCAGACAGTACCAACGCTTATGCTCGAGCATAAGCGTTGGTACTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007348.2-1158s21c1
Sequence:CCGGCAGAGAACCAGAGGCTTAAAGCTCGAGCTTTAAGCCTCTGGTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_129579
VALIDATED
ATF6 MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129579.3-4307s1c1
Sequence:CCGGGCTCGGTAGTTTGTATCTTAACTCGAGTTAAGATACAAACTACCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129579.3-1780s1c1
Sequence:CCGGCGAAGGGATCATCTGCTATTACTCGAGTAATAGCAGATGATCCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129579.3-673s1c1
Sequence:CCGGGCCATCATCATTCAGACACTACTCGAGTAGTGTCTGAATGATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129579.3-1908s1c1
Sequence:CCGGGCAGATTGACTGTCAGGTGATCTCGAGATCACCTGACAGTCAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129579.3-1201s1c1
Sequence:CCGGGCTGTCTGTGTGATGATAGTACTCGAGTACTATCATCACACAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_129579
VALIDATED
ATF6 MISSION shRNA shRNA Plasmid DNA
activating transcription factor 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129579.3-4307s1c1
Sequence:CCGGGCTCGGTAGTTTGTATCTTAACTCGAGTTAAGATACAAACTACCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129579.3-1780s1c1
Sequence:CCGGCGAAGGGATCATCTGCTATTACTCGAGTAATAGCAGATGATCCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129579.3-673s1c1
Sequence:CCGGGCCATCATCATTCAGACACTACTCGAGTAGTGTCTGAATGATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129579.3-1908s1c1
Sequence:CCGGGCAGATTGACTGTCAGGTGATCTCGAGATCACCTGACAGTCAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129579.3-1201s1c1
Sequence:CCGGGCTGTCTGTGTGATGATAGTACTCGAGTACTATCATCACACAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_129579
VALIDATED
ATF6 MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129579.3-4307s1c1
Sequence:CCGGGCTCGGTAGTTTGTATCTTAACTCGAGTTAAGATACAAACTACCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129579.3-1780s1c1
Sequence:CCGGCGAAGGGATCATCTGCTATTACTCGAGTAATAGCAGATGATCCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129579.3-673s1c1
Sequence:CCGGGCCATCATCATTCAGACACTACTCGAGTAGTGTCTGAATGATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129579.3-1908s1c1
Sequence:CCGGGCAGATTGACTGTCAGGTGATCTCGAGATCACCTGACAGTCAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129579.3-1201s1c1
Sequence:CCGGGCTGTCTGTGTGATGATAGTACTCGAGTACTATCATCACACAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081304
VALIDATED
ATF6 MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081304.1-635s21c1
Sequence:CCGGGCCATCATCATTCAGACACTACTCGAGTAGTGTCTGAATGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081304.1-673s21c1
Sequence:CCGGGGCAAAGCAGCAGTCGATTATCTCGAGATAATCGACTGCTGCTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081304.1-1163s21c1
Sequence:CCGGGCTGTCTGTGTGATGATAGTACTCGAGTACTATCATCACACAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081304.1-433s21c1
Sequence:CCGGATATGGCGACAGCTGTAATAGCTCGAGCTATTACAGCTGTCGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081304.1-1366s21c1
Sequence:CCGGGTCCAATGACAAAGCTTTAATCTCGAGATTAAAGCTTTGTCATTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081304
VALIDATED
ATF6 MISSION shRNA shRNA Plasmid DNA
activating transcription factor 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081304.1-635s21c1
Sequence:CCGGGCCATCATCATTCAGACACTACTCGAGTAGTGTCTGAATGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081304.1-673s21c1
Sequence:CCGGGGCAAAGCAGCAGTCGATTATCTCGAGATAATCGACTGCTGCTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081304.1-1163s21c1
Sequence:CCGGGCTGTCTGTGTGATGATAGTACTCGAGTACTATCATCACACAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081304.1-433s21c1
Sequence:CCGGATATGGCGACAGCTGTAATAGCTCGAGCTATTACAGCTGTCGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081304.1-1366s21c1
Sequence:CCGGGTCCAATGACAAAGCTTTAATCTCGAGATTAAAGCTTTGTCATTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081304
VALIDATED
ATF6 MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081304.1-635s21c1
Sequence:CCGGGCCATCATCATTCAGACACTACTCGAGTAGTGTCTGAATGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081304.1-673s21c1
Sequence:CCGGGGCAAAGCAGCAGTCGATTATCTCGAGATAATCGACTGCTGCTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081304.1-1163s21c1
Sequence:CCGGGCTGTCTGTGTGATGATAGTACTCGAGTACTATCATCACACAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081304.1-433s21c1
Sequence:CCGGATATGGCGACAGCTGTAATAGCTCGAGCTATTACAGCTGTCGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081304.1-1366s21c1
Sequence:CCGGGTCCAATGACAAAGCTTTAATCTCGAGATTAAAGCTTTGTCATTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks