EMAIL THIS PAGE TO A FRIEND

ATF6B

activating transcription factor 6 beta

168 Gene Product Result for
Synonyms: CREB-RP CREBL1 G13
Gene ID:
Human(1388) Summary: The protein encoded by this gene is a transcription factor in the unfolded protein response (UPR) pathway during ER stress. Either as a homodimer or as a heterodimer with ATF6-alpha, the encoded protein binds to the ER stress response element, interacting with nuclear transcription factor Y to activate UPR target genes. The protein is normally found in the membrane of the endoplasmic reticulum; however, under ER stress, the N-terminal cytoplasmic domain is cleaved from the rest of the protein and translocates to the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(12915) activating transcription factor 6 beta
Rat(406169) activating transcription factor 6 beta
naked mole-rat(101715793) activating transcription factor 6 beta
domestic guinea pig(100726957) activating transcription factor 6 beta
sheep(101113631) activating transcription factor 6 beta
Domestic Rabbit(100357489) activating transcription factor 6 beta
Zebrafish(777612) activating transcription factor 6 beta
Horse(100059348) activating transcription factor 6 beta
cow(513928) activating transcription factor 6 beta
domestic cat(101094849) activating transcription factor 6 beta
dog(474855) activating transcription factor 6 beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004381 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004381 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004381 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004381 Rosetta Predictions human pricing
NM_001002809 Rosetta Predictions rat pricing
NM_017406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021614 predicted 2145
2 SASI_Hs01_00021616 predicted 1220
3 SASI_Hs01_00021618 predicted 1068
4 SASI_Hs01_00021619 predicted 1766
5 SASI_Hs01_00021620 predicted 1189
6 SASI_Hs01_00021621 predicted 1533
7 SASI_Hs02_00337471 predicted 1661
8 SASI_Hs01_00021622 predicted 774
9 SASI_Hs01_00021623 predicted 1523
10 SASI_Hs02_00337472 predicted 2202
11 SASI_Hs01_00021615 predicted 456
12 SASI_Hs01_00021617 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002809 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084739 predicted 1929
2 SASI_Rn01_00084741 predicted 678
3 SASI_Rn01_00084742 predicted 1920
4 SASI_Rn01_00084743 predicted 1740
5 SASI_Rn01_00084744 predicted 292
6 SASI_Rn01_00084745 predicted 1773
7 SASI_Rn01_00084746 predicted 1769
8 SASI_Rn01_00084747 predicted 2110
9 SASI_Rn01_00084748 predicted 1958
10 SASI_Rn02_00197996 predicted 486
11 SASI_Rn01_00084740 predicted 1585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110468 predicted 2173
2 SASI_Mm02_00323919 predicted 1552
3 SASI_Mm01_00110469 predicted 1998
4 SASI_Mm01_00110470 predicted 725
5 SASI_Mm01_00110471 predicted 1965
6 SASI_Mm02_00323920 predicted 500
7 SASI_Mm01_00110473 predicted 889
8 SASI_Mm02_00323921 predicted 498
9 SASI_Mm02_00323922 predicted 1253
10 SASI_Mm01_00110475 predicted 1032
11 SASI_Mm01_00110472 predicted 1273
12 SASI_Mm01_00110474 predicted 1857
13 SASI_Mm01_00110476 predicted 1815
14 SASI_Mm01_00110477 predicted 1828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004381
VALIDATED
ATF6B MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 6 beta
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-1247s21c1
Sequence:CCGGTCTTCATTGCCTTCAACTTTGCTCGAGCAAAGTTGAAGGCAATGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004381.4-2408s21c1
Sequence:CCGGGTGGTGAGCTGCTGCATATTTCTCGAGAAATATGCAGCAGCTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-445s21c1
Sequence:CCGGGATGACCCAACATCCTCATTTCTCGAGAAATGAGGATGTTGGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-469s21c1
Sequence:CCGGACCGTCCAGATCAACGTTATCCTCGAGGATAACGTTGATCTGGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004381.4-2324s21c1
Sequence:CCGGATATAGGGCTCCTCTCATTCCCTCGAGGGAATGAGAGGAGCCCTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-509s21c1
Sequence:CCGGCAGATGTCCAGACCAAGATAGCTCGAGCTATCTTGGTCTGGACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-768s21c1
Sequence:CCGGGCCCAAACCTGTAGTGCTAACCTCGAGGTTAGCACTACAGGTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-1482s21c1
Sequence:CCGGCGCCAAGGAGCTACTACTAAGCTCGAGCTTAGTAGTAGCTCCTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004381.4-2380s21c1
Sequence:CCGGGATTGTGTGAGGTTCAGTTGTCTCGAGACAACTGAACCTCACACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-1662s21c1
Sequence:CCGGGAAGAAGTCACCTCCAGTTAACTCGAGTTAACTGGAGGTGACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-877s21c1
Sequence:CCGGGTCCTCATCCAGGGTGCTATTCTCGAGAATAGCACCCTGGATGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004381.3-2151s1c1
Sequence:CCGGGCCATTCACACTGACTTAGAACTCGAGTTCTAAGTCAGTGTGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_004381.3-399s1c1
Sequence:CCGGCCATGTGAAGACAGAGTCCTTCTCGAGAAGGACTCTGTCTTCACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_004381.3-537s1c1
Sequence:CCGGCTCTCCATGTTCTTCCGTCAACTCGAGTTGACGGAAGAACATGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_004381.3-1768s1c1
Sequence:CCGGCCAGCATTCTTGGATGCAATTCTCGAGAATTGCATCCAAGAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_004381.3-1194s1c1
Sequence:CCGGGCTCAAGTTAGGGTCTGGAAACTCGAGTTTCCAGACCCTAACTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004381
VALIDATED
ATF6B MISSION shRNA shRNA Plasmid DNA
activating transcription factor 6 beta
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-1247s21c1
Sequence:CCGGTCTTCATTGCCTTCAACTTTGCTCGAGCAAAGTTGAAGGCAATGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004381.4-2408s21c1
Sequence:CCGGGTGGTGAGCTGCTGCATATTTCTCGAGAAATATGCAGCAGCTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-445s21c1
Sequence:CCGGGATGACCCAACATCCTCATTTCTCGAGAAATGAGGATGTTGGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-469s21c1
Sequence:CCGGACCGTCCAGATCAACGTTATCCTCGAGGATAACGTTGATCTGGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004381.4-2324s21c1
Sequence:CCGGATATAGGGCTCCTCTCATTCCCTCGAGGGAATGAGAGGAGCCCTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-509s21c1
Sequence:CCGGCAGATGTCCAGACCAAGATAGCTCGAGCTATCTTGGTCTGGACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-768s21c1
Sequence:CCGGGCCCAAACCTGTAGTGCTAACCTCGAGGTTAGCACTACAGGTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-1482s21c1
Sequence:CCGGCGCCAAGGAGCTACTACTAAGCTCGAGCTTAGTAGTAGCTCCTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004381.4-2380s21c1
Sequence:CCGGGATTGTGTGAGGTTCAGTTGTCTCGAGACAACTGAACCTCACACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-1662s21c1
Sequence:CCGGGAAGAAGTCACCTCCAGTTAACTCGAGTTAACTGGAGGTGACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-877s21c1
Sequence:CCGGGTCCTCATCCAGGGTGCTATTCTCGAGAATAGCACCCTGGATGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004381.3-2151s1c1
Sequence:CCGGGCCATTCACACTGACTTAGAACTCGAGTTCTAAGTCAGTGTGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_004381.3-399s1c1
Sequence:CCGGCCATGTGAAGACAGAGTCCTTCTCGAGAAGGACTCTGTCTTCACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_004381.3-537s1c1
Sequence:CCGGCTCTCCATGTTCTTCCGTCAACTCGAGTTGACGGAAGAACATGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_004381.3-1768s1c1
Sequence:CCGGCCAGCATTCTTGGATGCAATTCTCGAGAATTGCATCCAAGAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_004381.3-1194s1c1
Sequence:CCGGGCTCAAGTTAGGGTCTGGAAACTCGAGTTTCCAGACCCTAACTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004381
VALIDATED
ATF6B MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 6 beta
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-1247s21c1
Sequence:CCGGTCTTCATTGCCTTCAACTTTGCTCGAGCAAAGTTGAAGGCAATGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004381.4-2408s21c1
Sequence:CCGGGTGGTGAGCTGCTGCATATTTCTCGAGAAATATGCAGCAGCTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-445s21c1
Sequence:CCGGGATGACCCAACATCCTCATTTCTCGAGAAATGAGGATGTTGGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-469s21c1
Sequence:CCGGACCGTCCAGATCAACGTTATCCTCGAGGATAACGTTGATCTGGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004381.4-2324s21c1
Sequence:CCGGATATAGGGCTCCTCTCATTCCCTCGAGGGAATGAGAGGAGCCCTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-509s21c1
Sequence:CCGGCAGATGTCCAGACCAAGATAGCTCGAGCTATCTTGGTCTGGACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-768s21c1
Sequence:CCGGGCCCAAACCTGTAGTGCTAACCTCGAGGTTAGCACTACAGGTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-1482s21c1
Sequence:CCGGCGCCAAGGAGCTACTACTAAGCTCGAGCTTAGTAGTAGCTCCTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004381.4-2380s21c1
Sequence:CCGGGATTGTGTGAGGTTCAGTTGTCTCGAGACAACTGAACCTCACACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-1662s21c1
Sequence:CCGGGAAGAAGTCACCTCCAGTTAACTCGAGTTAACTGGAGGTGACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004381.4-877s21c1
Sequence:CCGGGTCCTCATCCAGGGTGCTATTCTCGAGAATAGCACCCTGGATGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004381.3-2151s1c1
Sequence:CCGGGCCATTCACACTGACTTAGAACTCGAGTTCTAAGTCAGTGTGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_004381.3-399s1c1
Sequence:CCGGCCATGTGAAGACAGAGTCCTTCTCGAGAAGGACTCTGTCTTCACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_004381.3-537s1c1
Sequence:CCGGCTCTCCATGTTCTTCCGTCAACTCGAGTTGACGGAAGAACATGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_004381.3-1768s1c1
Sequence:CCGGCCAGCATTCTTGGATGCAATTCTCGAGAATTGCATCCAAGAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_004381.3-1194s1c1
Sequence:CCGGGCTCAAGTTAGGGTCTGGAAACTCGAGTTTCCAGACCCTAACTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017406
VALIDATED
ATF6B MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 6 beta
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017406.3-2170s21c1
Sequence:CCGGAGTGACTTAGAACCGGGTTAGCTCGAGCTAACCCGGTTCTAAGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017406.3-349s21c1
Sequence:CCGGCTCAGAGTCCTCACATCTTTCCTCGAGGAAAGATGTGAGGACTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017406.3-1617s21c1
Sequence:CCGGAGAGAGGTCGACGGAAGATACCTCGAGGTATCTTCCGTCGACCTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017406.2-2410s1c1
Sequence:CCGGCCTCTTCATTCTCTCCTTTATCTCGAGATAAAGGAGAGAATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017406.2-822s1c1
Sequence:CCGGCCTGTGGTACTAACCACAGTTCTCGAGAACTGTGGTTAGTACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017406.2-984s1c1
Sequence:CCGGCCTGAGAGGAAGAGCATTGTTCTCGAGAACAATGCTCTTCCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017406.2-765s1c1
Sequence:CCGGCCTGATAGTTCCTCAGGGAAACTCGAGTTTCCCTGAGGAACTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017406.2-1815s1c1
Sequence:CCGGCCGGAGTTTCTAGACGCAATTCTCGAGAATTGCGTCTAGAAACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017406
VALIDATED
ATF6B MISSION shRNA shRNA Plasmid DNA
activating transcription factor 6 beta
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017406.3-2170s21c1
Sequence:CCGGAGTGACTTAGAACCGGGTTAGCTCGAGCTAACCCGGTTCTAAGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017406.3-349s21c1
Sequence:CCGGCTCAGAGTCCTCACATCTTTCCTCGAGGAAAGATGTGAGGACTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017406.3-1617s21c1
Sequence:CCGGAGAGAGGTCGACGGAAGATACCTCGAGGTATCTTCCGTCGACCTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017406.2-2410s1c1
Sequence:CCGGCCTCTTCATTCTCTCCTTTATCTCGAGATAAAGGAGAGAATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017406.2-822s1c1
Sequence:CCGGCCTGTGGTACTAACCACAGTTCTCGAGAACTGTGGTTAGTACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017406.2-984s1c1
Sequence:CCGGCCTGAGAGGAAGAGCATTGTTCTCGAGAACAATGCTCTTCCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017406.2-765s1c1
Sequence:CCGGCCTGATAGTTCCTCAGGGAAACTCGAGTTTCCCTGAGGAACTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017406.2-1815s1c1
Sequence:CCGGCCGGAGTTTCTAGACGCAATTCTCGAGAATTGCGTCTAGAAACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017406
VALIDATED
ATF6B MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 6 beta
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017406.3-2170s21c1
Sequence:CCGGAGTGACTTAGAACCGGGTTAGCTCGAGCTAACCCGGTTCTAAGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017406.3-349s21c1
Sequence:CCGGCTCAGAGTCCTCACATCTTTCCTCGAGGAAAGATGTGAGGACTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017406.3-1617s21c1
Sequence:CCGGAGAGAGGTCGACGGAAGATACCTCGAGGTATCTTCCGTCGACCTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017406.2-2410s1c1
Sequence:CCGGCCTCTTCATTCTCTCCTTTATCTCGAGATAAAGGAGAGAATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017406.2-822s1c1
Sequence:CCGGCCTGTGGTACTAACCACAGTTCTCGAGAACTGTGGTTAGTACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017406.2-984s1c1
Sequence:CCGGCCTGAGAGGAAGAGCATTGTTCTCGAGAACAATGCTCTTCCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017406.2-765s1c1
Sequence:CCGGCCTGATAGTTCCTCAGGGAAACTCGAGTTTCCCTGAGGAACTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017406.2-1815s1c1
Sequence:CCGGCCGGAGTTTCTAGACGCAATTCTCGAGAATTGCGTCTAGAAACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks