EMAIL THIS PAGE TO A FRIEND

ATF7

activating transcription factor 7

99 Gene Product Result for
Synonyms: ATFA
Gene ID:
Mouse(223922) activating transcription factor 7
Rat(315333) activating transcription factor 7
chicken(769661) activating transcription factor 7
cow(541204) activating transcription factor 7
Horse(100062229) activating transcription factor 7
domestic cat(101088254) activating transcription factor 7
dog(607149) activating transcription factor 7
sheep(101123619) activating transcription factor 7
Domestic Rabbit(100351569) activating transcription factor 7
domestic guinea pig(100725948) activating transcription factor 7
naked mole-rat(101699947) activating transcription factor 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146065 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146065 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146065 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006856 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006856 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006856 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006856 Rosetta Predictions human pricing
NM_001108115 Rosetta Predictions rat pricing
NM_146065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222917 predicted 1193
2 SASI_Hs01_00222918 predicted 1073
3 SASI_Hs01_00222919 predicted 732
4 SASI_Hs01_00222920 predicted 847
5 SASI_Hs01_00222922 predicted 1212
6 SASI_Hs01_00222923 predicted 685
7 SASI_Hs02_00342469 predicted 689
8 SASI_Hs01_00222924 predicted 582
9 SASI_Hs01_00222925 predicted 1314
10 SASI_Hs01_00222926 predicted 1230
11 SASI_Hs01_00222921 predicted 1224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235504 predicted 1208
2 SASI_Rn02_00235505 predicted 326
3 SASI_Rn02_00235506 predicted 320
4 SASI_Rn02_00235507 predicted 911
5 SASI_Rn02_00235508 predicted 1661
6 SASI_Rn02_00235509 predicted 1222
7 SASI_Rn02_00235510 predicted 703
8 SASI_Rn02_00235511 predicted 584
9 SASI_Rn02_00235512 predicted 897
10 SASI_Rn02_00235513 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037574 predicted 1786
2 SASI_Mm01_00037575 predicted 1170
3 SASI_Mm01_00037576 predicted 1626
4 SASI_Mm01_00037577 predicted 207
5 SASI_Mm01_00037578 predicted 871
6 SASI_Mm01_00037579 predicted 552
7 SASI_Mm01_00037580 predicted 290
8 SASI_Mm01_00037582 predicted 310
9 SASI_Mm01_00037583 predicted 1658
10 SASI_Mm02_00341683 predicted 715
11 SASI_Mm01_00037581 predicted 1765
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146065
ATF7 MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146065.1-1463s1c1
Sequence:CCGGCGGTAGTTCAATCTGTGTTATCTCGAGATAACACAGATTGAACTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146065.1-154s1c1
Sequence:CCGGGCAGTTCATAAACATAAGCATCTCGAGATGCTTATGTTTATGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146065.1-1248s1c1
Sequence:CCGGGCAGCTACTGTTAGCTCATAACTCGAGTTATGAGCTAACAGTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146065.1-212s1c1
Sequence:CCGGCAGTCATCATTGCAGATCAAACTCGAGTTTGATCTGCAATGATGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146065.1-876s1c1
Sequence:CCGGCCATCAAGTTTCTTCAATCAACTCGAGTTGATTGAAGAAACTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146065.1-780s21c1
Sequence:CCGGTATACCTGGCCCACCGGTTAACTCGAGTTAACCGGTGGGCCAGGTATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146065.1-1565s21c1
Sequence:CCGGATGAAGTAGCCATCCTATTTGCTCGAGCAAATAGGATGGCTACTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146065.1-1361s21c1
Sequence:CCGGTATTGAGTATCTTAGGTATTCCTCGAGGAATACCTAAGATACTCAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146065.1-1335s21c1
Sequence:CCGGAGCGAAATCAGTTGGTAAATCCTCGAGGATTTACCAACTGATTTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146065
ATF7 MISSION shRNA shRNA Plasmid DNA
activating transcription factor 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146065.1-1463s1c1
Sequence:CCGGCGGTAGTTCAATCTGTGTTATCTCGAGATAACACAGATTGAACTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146065.1-154s1c1
Sequence:CCGGGCAGTTCATAAACATAAGCATCTCGAGATGCTTATGTTTATGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146065.1-1248s1c1
Sequence:CCGGGCAGCTACTGTTAGCTCATAACTCGAGTTATGAGCTAACAGTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146065.1-212s1c1
Sequence:CCGGCAGTCATCATTGCAGATCAAACTCGAGTTTGATCTGCAATGATGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146065.1-876s1c1
Sequence:CCGGCCATCAAGTTTCTTCAATCAACTCGAGTTGATTGAAGAAACTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146065.1-780s21c1
Sequence:CCGGTATACCTGGCCCACCGGTTAACTCGAGTTAACCGGTGGGCCAGGTATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146065.1-1565s21c1
Sequence:CCGGATGAAGTAGCCATCCTATTTGCTCGAGCAAATAGGATGGCTACTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146065.1-1361s21c1
Sequence:CCGGTATTGAGTATCTTAGGTATTCCTCGAGGAATACCTAAGATACTCAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146065.1-1335s21c1
Sequence:CCGGAGCGAAATCAGTTGGTAAATCCTCGAGGATTTACCAACTGATTTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146065
ATF7 MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146065.1-1463s1c1
Sequence:CCGGCGGTAGTTCAATCTGTGTTATCTCGAGATAACACAGATTGAACTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146065.1-154s1c1
Sequence:CCGGGCAGTTCATAAACATAAGCATCTCGAGATGCTTATGTTTATGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146065.1-1248s1c1
Sequence:CCGGGCAGCTACTGTTAGCTCATAACTCGAGTTATGAGCTAACAGTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146065.1-212s1c1
Sequence:CCGGCAGTCATCATTGCAGATCAAACTCGAGTTTGATCTGCAATGATGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146065.1-876s1c1
Sequence:CCGGCCATCAAGTTTCTTCAATCAACTCGAGTTGATTGAAGAAACTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146065.1-780s21c1
Sequence:CCGGTATACCTGGCCCACCGGTTAACTCGAGTTAACCGGTGGGCCAGGTATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146065.1-1565s21c1
Sequence:CCGGATGAAGTAGCCATCCTATTTGCTCGAGCAAATAGGATGGCTACTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146065.1-1361s21c1
Sequence:CCGGTATTGAGTATCTTAGGTATTCCTCGAGGAATACCTAAGATACTCAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146065.1-1335s21c1
Sequence:CCGGAGCGAAATCAGTTGGTAAATCCTCGAGGATTTACCAACTGATTTCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006856
VALIDATED
ATF7 MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006856.1-1501s1c1
Sequence:CCGGGCCGATACAATCGCATGTAATCTCGAGATTACATGCGATTGTATCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006856.1-1195s1c1
Sequence:CCGGCGAAGAACTCACTTCTCAGAACTCGAGTTCTGAGAAGTGAGTTCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006856.1-1232s1c1
Sequence:CCGGGAAGTCACATTACTACGCAATCTCGAGATTGCGTAGTAATGTGACTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006856.1-176s1c1
Sequence:CCGGGCAGTTCATAAACACAAGCATCTCGAGATGCTTGTGTTTATGAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006856.1-223s1c1
Sequence:CCGGCCGAACTGACTCAGTCATCATCTCGAGATGATGACTGAGTCAGTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006856.2-1250s21c1
Sequence:CCGGCGAAGAACTCACTTCTCAGAACTCGAGTTCTGAGAAGTGAGTTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006856.2-857s21c1
Sequence:CCGGTATCCCTGGCCCACCAGTTAACTCGAGTTAACTGGTGGGCCAGGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006856.2-955s21c1
Sequence:CCGGACCAAGTCTCCTCAATCAATGCTCGAGCATTGATTGAGGAGACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006856.2-278s21c1
Sequence:CCGGCCGAACTGACTCAGTCATCATCTCGAGATGATGACTGAGTCAGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_006856.2-2046s21c1
Sequence:CCGGGCTAGATTTGATGACATATTACTCGAGTAATATGTCATCAAATCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006856
VALIDATED
ATF7 MISSION shRNA shRNA Plasmid DNA
activating transcription factor 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006856.1-1501s1c1
Sequence:CCGGGCCGATACAATCGCATGTAATCTCGAGATTACATGCGATTGTATCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006856.1-1195s1c1
Sequence:CCGGCGAAGAACTCACTTCTCAGAACTCGAGTTCTGAGAAGTGAGTTCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006856.1-1232s1c1
Sequence:CCGGGAAGTCACATTACTACGCAATCTCGAGATTGCGTAGTAATGTGACTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006856.1-176s1c1
Sequence:CCGGGCAGTTCATAAACACAAGCATCTCGAGATGCTTGTGTTTATGAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006856.1-223s1c1
Sequence:CCGGCCGAACTGACTCAGTCATCATCTCGAGATGATGACTGAGTCAGTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006856.2-1250s21c1
Sequence:CCGGCGAAGAACTCACTTCTCAGAACTCGAGTTCTGAGAAGTGAGTTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006856.2-857s21c1
Sequence:CCGGTATCCCTGGCCCACCAGTTAACTCGAGTTAACTGGTGGGCCAGGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006856.2-955s21c1
Sequence:CCGGACCAAGTCTCCTCAATCAATGCTCGAGCATTGATTGAGGAGACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006856.2-278s21c1
Sequence:CCGGCCGAACTGACTCAGTCATCATCTCGAGATGATGACTGAGTCAGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_006856.2-2046s21c1
Sequence:CCGGGCTAGATTTGATGACATATTACTCGAGTAATATGTCATCAAATCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006856
VALIDATED
ATF7 MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006856.1-1501s1c1
Sequence:CCGGGCCGATACAATCGCATGTAATCTCGAGATTACATGCGATTGTATCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006856.1-1195s1c1
Sequence:CCGGCGAAGAACTCACTTCTCAGAACTCGAGTTCTGAGAAGTGAGTTCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006856.1-1232s1c1
Sequence:CCGGGAAGTCACATTACTACGCAATCTCGAGATTGCGTAGTAATGTGACTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006856.1-176s1c1
Sequence:CCGGGCAGTTCATAAACACAAGCATCTCGAGATGCTTGTGTTTATGAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006856.1-223s1c1
Sequence:CCGGCCGAACTGACTCAGTCATCATCTCGAGATGATGACTGAGTCAGTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006856.2-1250s21c1
Sequence:CCGGCGAAGAACTCACTTCTCAGAACTCGAGTTCTGAGAAGTGAGTTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006856.2-857s21c1
Sequence:CCGGTATCCCTGGCCCACCAGTTAACTCGAGTTAACTGGTGGGCCAGGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006856.2-955s21c1
Sequence:CCGGACCAAGTCTCCTCAATCAATGCTCGAGCATTGATTGAGGAGACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006856.2-278s21c1
Sequence:CCGGCCGAACTGACTCAGTCATCATCTCGAGATGATGACTGAGTCAGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_006856.2-2046s21c1
Sequence:CCGGGCTAGATTTGATGACATATTACTCGAGTAATATGTCATCAAATCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)