EMAIL THIS PAGE TO A FRIEND

ATF7IP2

activating transcription factor 7 interacting protein 2

144 Gene Product Result for
Synonyms: MCAF2
Gene ID:
Mouse(75329) activating transcription factor 7 interacting protein 2
Rat(497859) activating transcription factor 7 interacting protein 2
sheep(101107247) activating transcription factor 7 interacting protein 2
domestic guinea pig(100725249) activating transcription factor 7 interacting protein 2
naked mole-rat(101717404) activating transcription factor 7 interacting protein 2
dog(479852) activating transcription factor 7 interacting protein 2
cow(529852) activating transcription factor 7 interacting protein 2
Horse(100057122) activating transcription factor 7 interacting protein 2
domestic cat(101085850) activating transcription factor 7 interacting protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_358760 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358760 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358760 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024997 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024997 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024997 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024997 Rosetta Predictions human pricing
NM_001017471 Rosetta Predictions rat pricing
XM_148109 Rosetta Predictions mouse pricing
XM_489510 Rosetta Predictions mouse pricing
XM_897318 Rosetta Predictions mouse pricing
XM_897341 Rosetta Predictions mouse pricing
XM_897350 Rosetta Predictions mouse pricing
XM_897362 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058951 predicted 1134
2 SASI_Hs01_00058952 predicted 1642
3 SASI_Hs01_00058953 predicted 852
4 SASI_Hs01_00058955 predicted 1377
5 SASI_Hs02_00357652 predicted 1349
6 SASI_Hs01_00058956 predicted 671
7 SASI_Hs02_00357653 predicted 976
8 SASI_Hs01_00058957 predicted 765
9 SASI_Hs01_00058959 predicted 950
10 SASI_Hs02_00357654 predicted 1304
11 SASI_Hs01_00058954 predicted 2002
12 SASI_Hs01_00058958 predicted 1509
13 SASI_Hs01_00058960 predicted 1938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017471 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038757 predicted 328
2 SASI_Rn01_00038758 predicted 553
3 SASI_Rn01_00038760 predicted 533
4 SASI_Rn01_00038761 predicted 829
5 SASI_Rn01_00038762 predicted 527
6 SASI_Rn01_00038763 predicted 770
7 SASI_Rn01_00038764 predicted 198
8 SASI_Rn02_00202278 predicted 568
9 SASI_Rn01_00038765 predicted 845
10 SASI_Rn01_00038766 predicted 1148
11 SASI_Rn01_00038759 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_148109 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212134 predicted 2155
2 SASI_Mm01_00212135 predicted 2021
3 SASI_Mm02_00425352 predicted 1100
4 SASI_Mm01_00212136 predicted 1640
5 SASI_Mm01_00212137 predicted 1809
6 SASI_Mm01_00212139 predicted 1486
7 SASI_Mm01_00212140 predicted 1969
8 SASI_Mm01_00212141 predicted 2158
9 SASI_Mm01_00212142 predicted 2002
10 SASI_Mm01_00212143 predicted 2009
11 SASI_Mm01_00212138 predicted 2129
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_489510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427223 predicted 781
2 SASI_Mm02_00427224 predicted 576
3 SASI_Mm02_00427225 predicted 454
4 SASI_Mm02_00427226 predicted 1105
5 SASI_Mm02_00427227 predicted 1643
6 SASI_Mm02_00427228 predicted 1492
7 SASI_Mm02_00427229 predicted 505
8 SASI_Mm02_00427230 predicted 831
9 SASI_Mm02_00427231 predicted 977
10 SASI_Mm02_00427232 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231164 predicted 809
2 SASI_Mm01_00231165 predicted 786
3 SASI_Mm01_00231166 predicted 616
4 SASI_Mm01_00231167 predicted 580
5 SASI_Mm01_00231168 predicted 458
6 SASI_Mm01_00231169 predicted 692
7 SASI_Mm01_00231170 predicted 513
8 SASI_Mm01_00231171 predicted 835
9 SASI_Mm01_00231172 predicted 937
10 SASI_Mm01_00231173 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269326 predicted 935
2 SASI_Mm01_00269327 predicted 954
3 SASI_Mm01_00269328 predicted 938
4 SASI_Mm01_00269329 predicted 959
5 SASI_Mm01_00269330 predicted 840
6 SASI_Mm01_00269331 predicted 945
7 SASI_Mm01_00269332 predicted 832
8 SASI_Mm01_00269333 predicted 934
9 SASI_Mm01_00269334 predicted 841
10 SASI_Mm01_00269335 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259488 predicted 791
2 SASI_Mm01_00259489 predicted 616
3 SASI_Mm01_00259490 predicted 581
4 SASI_Mm01_00259491 predicted 460
5 SASI_Mm01_00259492 predicted 1104
6 SASI_Mm01_00259493 predicted 695
7 SASI_Mm01_00259494 predicted 511
8 SASI_Mm01_00259495 predicted 842
9 SASI_Mm01_00259496 predicted 984
10 SASI_Mm01_00259497 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253418 predicted 783
2 SASI_Mm01_00253419 predicted 619
3 SASI_Mm01_00253420 predicted 801
4 SASI_Mm01_00253421 predicted 578
5 SASI_Mm01_00253422 predicted 701
6 SASI_Mm01_00253423 predicted 457
7 SASI_Mm01_00253424 predicted 841
8 SASI_Mm01_00253425 predicted 1046
9 SASI_Mm01_00253426 predicted 790
10 SASI_Mm01_00253427 predicted 611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358760
ATF7IP2 MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 7 interacting protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358760.1-951s1c1
Sequence:CCGGGCCATCAACTTGTGTTGAGTTCTCGAGAACTCAACACAAGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358760.1-1168s1c1
Sequence:CCGGCCGTCCAACTACAGCATAGAACTCGAGTTCTATGCTGTAGTTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358760.1-952s1c1
Sequence:CCGGCCATCAACTTGTGTTGAGTTTCTCGAGAAACTCAACACAAGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358760.1-572s1c1
Sequence:CCGGCAGCACTGCTAGAACAGGTTACTCGAGTAACCTGTTCTAGCAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358760.1-790s1c1
Sequence:CCGGCCAAACACATTACCCAGTAATCTCGAGATTACTGGGTAATGTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358760
ATF7IP2 MISSION shRNA shRNA Plasmid DNA
activating transcription factor 7 interacting protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358760.1-951s1c1
Sequence:CCGGGCCATCAACTTGTGTTGAGTTCTCGAGAACTCAACACAAGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358760.1-1168s1c1
Sequence:CCGGCCGTCCAACTACAGCATAGAACTCGAGTTCTATGCTGTAGTTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358760.1-952s1c1
Sequence:CCGGCCATCAACTTGTGTTGAGTTTCTCGAGAAACTCAACACAAGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358760.1-572s1c1
Sequence:CCGGCAGCACTGCTAGAACAGGTTACTCGAGTAACCTGTTCTAGCAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358760.1-790s1c1
Sequence:CCGGCCAAACACATTACCCAGTAATCTCGAGATTACTGGGTAATGTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358760
ATF7IP2 MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 7 interacting protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358760.1-951s1c1
Sequence:CCGGGCCATCAACTTGTGTTGAGTTCTCGAGAACTCAACACAAGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358760.1-1168s1c1
Sequence:CCGGCCGTCCAACTACAGCATAGAACTCGAGTTCTATGCTGTAGTTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358760.1-952s1c1
Sequence:CCGGCCATCAACTTGTGTTGAGTTTCTCGAGAAACTCAACACAAGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358760.1-572s1c1
Sequence:CCGGCAGCACTGCTAGAACAGGTTACTCGAGTAACCTGTTCTAGCAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358760.1-790s1c1
Sequence:CCGGCCAAACACATTACCCAGTAATCTCGAGATTACTGGGTAATGTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024997
ATF7IP2 MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 7 interacting protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024997.2-2077s1c1
Sequence:CCGGGCCTGTACTTTATCTCAGTTTCTCGAGAAACTGAGATAAAGTACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024997.2-670s1c1
Sequence:CCGGCCCAGTGTATTGAGTGGTGTTCTCGAGAACACCACTCAATACACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024997.2-773s1c1
Sequence:CCGGCCAATTCAGAATCACATGATACTCGAGTATCATGTGATTCTGAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024997.2-1744s1c1
Sequence:CCGGGCTGCTTCAAACTCAAAGGAACTCGAGTTCCTTTGAGTTTGAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024997.2-379s1c1
Sequence:CCGGGCATCCTCATTGGACTCTAATCTCGAGATTAGAGTCCAATGAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024997.2-2153s21c1
Sequence:CCGGATGGACCATTCTGTGATATAACTCGAGTTATATCACAGAATGGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024997.2-917s21c1
Sequence:CCGGAGTGTAGTAGAACCAGTATTTCTCGAGAAATACTGGTTCTACTACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024997.2-1130s21c1
Sequence:CCGGTGATTCAGCAGGAGATCTATACTCGAGTATAGATCTCCTGCTGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024997.2-289s21c1
Sequence:CCGGAGTAATGTTCCAAGCGGTAATCTCGAGATTACCGCTTGGAACATTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024997.2-1536s21c1
Sequence:CCGGTTCTGTGGAAAGTCCTAATTTCTCGAGAAATTAGGACTTTCCACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024997
ATF7IP2 MISSION shRNA shRNA Plasmid DNA
activating transcription factor 7 interacting protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024997.2-2077s1c1
Sequence:CCGGGCCTGTACTTTATCTCAGTTTCTCGAGAAACTGAGATAAAGTACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024997.2-670s1c1
Sequence:CCGGCCCAGTGTATTGAGTGGTGTTCTCGAGAACACCACTCAATACACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024997.2-773s1c1
Sequence:CCGGCCAATTCAGAATCACATGATACTCGAGTATCATGTGATTCTGAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024997.2-1744s1c1
Sequence:CCGGGCTGCTTCAAACTCAAAGGAACTCGAGTTCCTTTGAGTTTGAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024997.2-379s1c1
Sequence:CCGGGCATCCTCATTGGACTCTAATCTCGAGATTAGAGTCCAATGAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024997.2-2153s21c1
Sequence:CCGGATGGACCATTCTGTGATATAACTCGAGTTATATCACAGAATGGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024997.2-917s21c1
Sequence:CCGGAGTGTAGTAGAACCAGTATTTCTCGAGAAATACTGGTTCTACTACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024997.2-1130s21c1
Sequence:CCGGTGATTCAGCAGGAGATCTATACTCGAGTATAGATCTCCTGCTGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024997.2-289s21c1
Sequence:CCGGAGTAATGTTCCAAGCGGTAATCTCGAGATTACCGCTTGGAACATTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024997.2-1536s21c1
Sequence:CCGGTTCTGTGGAAAGTCCTAATTTCTCGAGAAATTAGGACTTTCCACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024997
ATF7IP2 MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 7 interacting protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024997.2-2077s1c1
Sequence:CCGGGCCTGTACTTTATCTCAGTTTCTCGAGAAACTGAGATAAAGTACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024997.2-670s1c1
Sequence:CCGGCCCAGTGTATTGAGTGGTGTTCTCGAGAACACCACTCAATACACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024997.2-773s1c1
Sequence:CCGGCCAATTCAGAATCACATGATACTCGAGTATCATGTGATTCTGAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024997.2-1744s1c1
Sequence:CCGGGCTGCTTCAAACTCAAAGGAACTCGAGTTCCTTTGAGTTTGAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024997.2-379s1c1
Sequence:CCGGGCATCCTCATTGGACTCTAATCTCGAGATTAGAGTCCAATGAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024997.2-2153s21c1
Sequence:CCGGATGGACCATTCTGTGATATAACTCGAGTTATATCACAGAATGGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024997.2-917s21c1
Sequence:CCGGAGTGTAGTAGAACCAGTATTTCTCGAGAAATACTGGTTCTACTACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024997.2-1130s21c1
Sequence:CCGGTGATTCAGCAGGAGATCTATACTCGAGTATAGATCTCCTGCTGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024997.2-289s21c1
Sequence:CCGGAGTAATGTTCCAAGCGGTAATCTCGAGATTACCGCTTGGAACATTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024997.2-1536s21c1
Sequence:CCGGTTCTGTGGAAAGTCCTAATTTCTCGAGAAATTAGGACTTTCCACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks