EMAIL THIS PAGE TO A FRIEND

ATF7IP

activating transcription factor 7 interacting protein

76 Gene Product Result for
Synonyms: AM MCAF MCAF1 p621
Gene ID:
Human(55729) Summary: ATF7IP is a multifunctional nuclear protein that associates with heterochromatin. It can act as a transcriptional coactivator or corepressor depending upon its binding partners (summary by Liu et al., 2009 [PubMed 19106100]
Mouse(54343) activating transcription factor 7 interacting protein
Rat(312800) activating transcription factor 7 interacting protein
Zebrafish(558977) activating transcription factor 7 interacting protein
chicken(417966) activating transcription factor 7 interacting protein
domestic cat(101094607) activating transcription factor 7 interacting protein
cow(781834) activating transcription factor 7 interacting protein
dog(486674) activating transcription factor 7 interacting protein
naked mole-rat(101721588) activating transcription factor 7 interacting protein
domestic guinea pig(100732385) activating transcription factor 7 interacting protein
sheep(101109004) activating transcription factor 7 interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019426 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019426 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019426 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018179 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018179 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018179 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018179 Rosetta Predictions human pricing
NM_001107893 Rosetta Predictions rat pricing
NM_019426 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227051 predicted 3262
2 SASI_Hs01_00227052 predicted 995
3 SASI_Hs01_00227053 predicted 3319
4 SASI_Hs01_00227054 predicted 592
5 SASI_Hs01_00227055 predicted 3286
6 SASI_Hs01_00227056 predicted 2855
7 SASI_Hs02_00351435 predicted 2353
8 SASI_Hs01_00227057 predicted 1927
9 SASI_Hs01_00227058 predicted 2787
10 SASI_Hs02_00351436 predicted 2117
11 SASI_Hs01_00227049 predicted 2509
12 SASI_Hs01_00227050 predicted 3124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107893 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233315 predicted 486
2 SASI_Rn02_00233316 predicted 650
3 SASI_Rn02_00233317 predicted 1113
4 SASI_Rn02_00233318 predicted 988
5 SASI_Rn02_00233319 predicted 1146
6 SASI_Rn02_00233320 predicted 411
7 SASI_Rn02_00233321 predicted 304
8 SASI_Rn02_00233322 predicted 1016
9 SASI_Rn02_00233323 predicted 347
10 SASI_Rn02_00233324 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141752 predicted 3332
2 SASI_Mm01_00141753 predicted 3109
3 SASI_Mm01_00141754 predicted 2901
4 SASI_Mm02_00324349 predicted 1976
5 SASI_Mm01_00141755 predicted 450
6 SASI_Mm01_00141757 predicted 315
7 SASI_Mm01_00141758 predicted 2625
8 SASI_Mm01_00141759 predicted 1170
9 SASI_Mm01_00141760 predicted 2422
10 SASI_Mm01_00141761 predicted 4049
11 SASI_Mm01_00141756 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019426
VALIDATED
ATF7IP MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 7 interacting protein
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019426.2-1149s21c1
Sequence:CCGGGACAGAGCCGAGTAGCAATAACTCGAGTTATTGCTACTCGGCTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019426.2-1201s21c1
Sequence:CCGGGACGAACACTTAGACCAAATTCTCGAGAATTTGGTCTAAGTGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019426.2-4146s21c1
Sequence:CCGGCCCGGACATGTGACTGTATACCTCGAGGTATACAGTCACATGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019426.2-4037s21c1
Sequence:CCGGGTTAGACCTTGGAGTCGTTTACTCGAGTAAACGACTCCAAGGTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019426.2-2932s21c1
Sequence:CCGGCGAGGCCCAATACAGATGAAACTCGAGTTTCATCTGTATTGGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019426.2-2767s21c1
Sequence:CCGGGTGCCCAGTCCTAGTAGTATTCTCGAGAATACTACTAGGACTGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019426.2-553s21c1
Sequence:CCGGGATAACCCAGCCTCCGATAACCTCGAGGTTATCGGAGGCTGGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019426.2-2626s1c1
Sequence:CCGGCCAGGGACTTTAGTGACCAATCTCGAGATTGGTCACTAAAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019426.2-458s1c1
Sequence:CCGGCCAGTATAACTTGTGATCTTTCTCGAGAAAGATCACAAGTTATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019426.2-4390s1c1
Sequence:CCGGCCTCTCAAATTTACCTCTCTTCTCGAGAAGAGAGGTAAATTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019426.2-2932s1c1
Sequence:CCGGCGAGGCCCAATACAGATGAAACTCGAGTTTCATCTGTATTGGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019426.2-1397s1c1
Sequence:CCGGGCAGCATGGAAGTTGACCAAACTCGAGTTTGGTCAACTTCCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019426
VALIDATED
ATF7IP MISSION shRNA shRNA Plasmid DNA
activating transcription factor 7 interacting protein
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019426.2-1149s21c1
Sequence:CCGGGACAGAGCCGAGTAGCAATAACTCGAGTTATTGCTACTCGGCTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019426.2-1201s21c1
Sequence:CCGGGACGAACACTTAGACCAAATTCTCGAGAATTTGGTCTAAGTGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019426.2-4146s21c1
Sequence:CCGGCCCGGACATGTGACTGTATACCTCGAGGTATACAGTCACATGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019426.2-4037s21c1
Sequence:CCGGGTTAGACCTTGGAGTCGTTTACTCGAGTAAACGACTCCAAGGTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019426.2-2932s21c1
Sequence:CCGGCGAGGCCCAATACAGATGAAACTCGAGTTTCATCTGTATTGGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019426.2-2767s21c1
Sequence:CCGGGTGCCCAGTCCTAGTAGTATTCTCGAGAATACTACTAGGACTGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019426.2-553s21c1
Sequence:CCGGGATAACCCAGCCTCCGATAACCTCGAGGTTATCGGAGGCTGGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019426.2-2626s1c1
Sequence:CCGGCCAGGGACTTTAGTGACCAATCTCGAGATTGGTCACTAAAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019426.2-458s1c1
Sequence:CCGGCCAGTATAACTTGTGATCTTTCTCGAGAAAGATCACAAGTTATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019426.2-4390s1c1
Sequence:CCGGCCTCTCAAATTTACCTCTCTTCTCGAGAAGAGAGGTAAATTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019426.2-2932s1c1
Sequence:CCGGCGAGGCCCAATACAGATGAAACTCGAGTTTCATCTGTATTGGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019426.2-1397s1c1
Sequence:CCGGGCAGCATGGAAGTTGACCAAACTCGAGTTTGGTCAACTTCCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019426
VALIDATED
ATF7IP MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 7 interacting protein
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019426.2-1149s21c1
Sequence:CCGGGACAGAGCCGAGTAGCAATAACTCGAGTTATTGCTACTCGGCTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019426.2-1201s21c1
Sequence:CCGGGACGAACACTTAGACCAAATTCTCGAGAATTTGGTCTAAGTGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019426.2-4146s21c1
Sequence:CCGGCCCGGACATGTGACTGTATACCTCGAGGTATACAGTCACATGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019426.2-4037s21c1
Sequence:CCGGGTTAGACCTTGGAGTCGTTTACTCGAGTAAACGACTCCAAGGTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019426.2-2932s21c1
Sequence:CCGGCGAGGCCCAATACAGATGAAACTCGAGTTTCATCTGTATTGGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019426.2-2767s21c1
Sequence:CCGGGTGCCCAGTCCTAGTAGTATTCTCGAGAATACTACTAGGACTGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019426.2-553s21c1
Sequence:CCGGGATAACCCAGCCTCCGATAACCTCGAGGTTATCGGAGGCTGGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019426.2-2626s1c1
Sequence:CCGGCCAGGGACTTTAGTGACCAATCTCGAGATTGGTCACTAAAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019426.2-458s1c1
Sequence:CCGGCCAGTATAACTTGTGATCTTTCTCGAGAAAGATCACAAGTTATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019426.2-4390s1c1
Sequence:CCGGCCTCTCAAATTTACCTCTCTTCTCGAGAAGAGAGGTAAATTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019426.2-2932s1c1
Sequence:CCGGCGAGGCCCAATACAGATGAAACTCGAGTTTCATCTGTATTGGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019426.2-1397s1c1
Sequence:CCGGGCAGCATGGAAGTTGACCAAACTCGAGTTTGGTCAACTTCCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018179
VALIDATED
ATF7IP MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 7 interacting protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018179.3-832s21c1
Sequence:CCGGCCGCTGATGATATAGCCTCTACTCGAGTAGAGGCTATATCATCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018179.3-1856s21c1
Sequence:CCGGGTCTAAACGTCGTCGATATATCTCGAGATATATCGACGACGTTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018179.3-432s21c1
Sequence:CCGGCCCTGTATCCTAAGTGTTAATCTCGAGATTAACACTTAGGATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018179.3-4315s21c1
Sequence:CCGGTACGAAGTAAGTAGATCAAAGCTCGAGCTTTGATCTACTTACTTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018179.3-1371s21c1
Sequence:CCGGGATCTTGTAGAAACGATTAATCTCGAGATTAATCGTTTCTACAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018179.3-2562s1c1
Sequence:CCGGCCAGGGACTTTGGTGACTAATCTCGAGATTAGTCACCAAAGTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018179.3-432s1c1
Sequence:CCGGCCCTGTATCCTAAGTGTTAATCTCGAGATTAACACTTAGGATACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018179.3-3892s1c1
Sequence:CCGGCCAAGGATATTTATGGACGTTCTCGAGAACGTCCATAAATATCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018179.3-1866s1c1
Sequence:CCGGCGTCGATATATGGAAGAAGAACTCGAGTTCTTCTTCCATATATCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018179
VALIDATED
ATF7IP MISSION shRNA shRNA Plasmid DNA
activating transcription factor 7 interacting protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018179.3-832s21c1
Sequence:CCGGCCGCTGATGATATAGCCTCTACTCGAGTAGAGGCTATATCATCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018179.3-1856s21c1
Sequence:CCGGGTCTAAACGTCGTCGATATATCTCGAGATATATCGACGACGTTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018179.3-432s21c1
Sequence:CCGGCCCTGTATCCTAAGTGTTAATCTCGAGATTAACACTTAGGATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018179.3-4315s21c1
Sequence:CCGGTACGAAGTAAGTAGATCAAAGCTCGAGCTTTGATCTACTTACTTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018179.3-1371s21c1
Sequence:CCGGGATCTTGTAGAAACGATTAATCTCGAGATTAATCGTTTCTACAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018179.3-2562s1c1
Sequence:CCGGCCAGGGACTTTGGTGACTAATCTCGAGATTAGTCACCAAAGTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018179.3-432s1c1
Sequence:CCGGCCCTGTATCCTAAGTGTTAATCTCGAGATTAACACTTAGGATACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018179.3-3892s1c1
Sequence:CCGGCCAAGGATATTTATGGACGTTCTCGAGAACGTCCATAAATATCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018179.3-1866s1c1
Sequence:CCGGCGTCGATATATGGAAGAAGAACTCGAGTTCTTCTTCCATATATCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018179
VALIDATED
ATF7IP MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 7 interacting protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018179.3-832s21c1
Sequence:CCGGCCGCTGATGATATAGCCTCTACTCGAGTAGAGGCTATATCATCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018179.3-1856s21c1
Sequence:CCGGGTCTAAACGTCGTCGATATATCTCGAGATATATCGACGACGTTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018179.3-432s21c1
Sequence:CCGGCCCTGTATCCTAAGTGTTAATCTCGAGATTAACACTTAGGATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018179.3-4315s21c1
Sequence:CCGGTACGAAGTAAGTAGATCAAAGCTCGAGCTTTGATCTACTTACTTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018179.3-1371s21c1
Sequence:CCGGGATCTTGTAGAAACGATTAATCTCGAGATTAATCGTTTCTACAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018179.3-2562s1c1
Sequence:CCGGCCAGGGACTTTGGTGACTAATCTCGAGATTAGTCACCAAAGTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018179.3-432s1c1
Sequence:CCGGCCCTGTATCCTAAGTGTTAATCTCGAGATTAACACTTAGGATACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018179.3-3892s1c1
Sequence:CCGGCCAAGGATATTTATGGACGTTCTCGAGAACGTCCATAAATATCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018179.3-1866s1c1
Sequence:CCGGCGTCGATATATGGAAGAAGAACTCGAGTTCTTCTTCCATATATCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks