EMAIL THIS PAGE TO A FRIEND

ATG10

autophagy related 10

101 Gene Product Result for
Synonyms: APG10 APG10L pp12616
UniProtKB ID: Q9H0Y0, B2RE09, Q6PIX1, Q9H842
Gene ID:
Human(83734) Summary: Autophagy is a process for the bulk degradation of cytosolic compartments by lysosomes. ATG10 is an E2-like enzyme involved in 2 ubiquitin-like modifications essential for autophagosome formation: ATG12 (MIM 609608)-ATG5 (MIM 604261) conjugation and modification of a soluble form of MAP-LC3 (MAP1LC3A; MIM 601242), a homolog of yeast Apg8, to a membrane-bound form (Nemoto et al., 2003 [PubMed 12890687]
Mouse(66795) autophagy related 10
Rat(688555) autophagy related 10
Zebrafish(641330) ATG10 autophagy related 10 homolog (S. cerevisiae)
chicken(427322) autophagy related 10
Thale Cress(819941) autophagocytosis-associated family protein
cow(787344) ATG10 autophagy related 10 homolog (S. cerevisiae)
domestic cat(101091921) autophagy related 10
dog(610103) autophagy related 10
naked mole-rat(101707298) autophagy related 10
domestic guinea pig(100728938) autophagy related 10
sheep(101122947) autophagy related 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031482 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU021871 MISSION® esiRNA esiRNA targeting mouse Atg10 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031482 Rosetta Predictions human pricing
NM_001109505 Rosetta Predictions rat pricing
NM_025770 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036616 predicted 492
2 SASI_Hs01_00036617 predicted 859
3 SASI_Hs01_00036618 predicted 556
4 SASI_Hs01_00036619 predicted 574
5 SASI_Hs01_00036620 predicted 769
6 SASI_Hs01_00036622 predicted 653
7 SASI_Hs01_00036623 predicted 911
8 SASI_Hs01_00036625 predicted 721
9 SASI_Hs02_00358917 predicted 901
10 SASI_Hs02_00358918 predicted 296
11 SASI_Hs01_00036621 predicted 814
12 SASI_Hs01_00036624 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249059 predicted 325
2 SASI_Rn02_00249060 predicted 914
3 SASI_Rn02_00249061 predicted 674
4 SASI_Rn02_00249062 predicted 625
5 SASI_Rn02_00249063 predicted 398
6 SASI_Rn02_00249064 predicted 365
7 SASI_Rn02_00249065 predicted 893
8 SASI_Rn02_00249066 predicted 694
9 SASI_Rn02_00249067 predicted 491
10 SASI_Rn02_00249068 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058043 predicted 563
2 SASI_Mm01_00058044 predicted 704
3 SASI_Mm01_00058045 predicted 312
4 SASI_Mm02_00328966 predicted 435
5 SASI_Mm01_00058046 predicted 314
6 SASI_Mm01_00058049 predicted 586
7 SASI_Mm02_00328967 predicted 563
8 SASI_Mm01_00058051 predicted 350
9 SASI_Mm01_00058052 predicted 787
10 SASI_Mm02_00328968 predicted 662
11 SASI_Mm01_00058047 predicted 401
12 SASI_Mm01_00058048 predicted 315
13 SASI_Mm01_00058050 predicted 477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025770
VALIDATED
ATG10 MISSION shRNA Bacterial Glycerol Stock
autophagy related 10
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025770.3-505s21c1
Sequence:CCGGCCAATACTTGGGCAACCATTTCTCGAGAAATGGTTGCCCAAGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025770.3-114s21c1
Sequence:CCGGCATCAGACATTCACAGCAGATCTCGAGATCTGCTGTGAATGTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025770.3-637s21c1
Sequence:CCGGCCAGTGGTTGGTCTGAATTTACTCGAGTAAATTCAGACCAACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025770.3-659s21c1
Sequence:CCGGCTCTGAGCTATGCTAAAGCAACTCGAGTTGCTTTAGCATAGCTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025770.2-78s1c1
Sequence:CCGGCATCAGACATTCACAGCAGATCTCGAGATCTGCTGTGAATGTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025770.2-635s1c1
Sequence:CCGGCTCTGAGCTATGCTAAAGCAACTCGAGTTGCTTTAGCATAGCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025770.2-613s1c1
Sequence:CCGGCCAGTGGTTGGTCTGAATTTACTCGAGTAAATTCAGACCAACCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025770.2-481s1c1
Sequence:CCGGCCAATACTTGGGCAACCATTTCTCGAGAAATGGTTGCCCAAGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025770
VALIDATED
ATG10 MISSION shRNA shRNA Plasmid DNA
autophagy related 10
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025770.3-505s21c1
Sequence:CCGGCCAATACTTGGGCAACCATTTCTCGAGAAATGGTTGCCCAAGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025770.3-114s21c1
Sequence:CCGGCATCAGACATTCACAGCAGATCTCGAGATCTGCTGTGAATGTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025770.3-637s21c1
Sequence:CCGGCCAGTGGTTGGTCTGAATTTACTCGAGTAAATTCAGACCAACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025770.3-659s21c1
Sequence:CCGGCTCTGAGCTATGCTAAAGCAACTCGAGTTGCTTTAGCATAGCTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025770.2-78s1c1
Sequence:CCGGCATCAGACATTCACAGCAGATCTCGAGATCTGCTGTGAATGTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025770.2-635s1c1
Sequence:CCGGCTCTGAGCTATGCTAAAGCAACTCGAGTTGCTTTAGCATAGCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025770.2-613s1c1
Sequence:CCGGCCAGTGGTTGGTCTGAATTTACTCGAGTAAATTCAGACCAACCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025770.2-481s1c1
Sequence:CCGGCCAATACTTGGGCAACCATTTCTCGAGAAATGGTTGCCCAAGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025770
VALIDATED
ATG10 MISSION shRNA Lentiviral Transduction Particles
autophagy related 10
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025770.3-505s21c1
Sequence:CCGGCCAATACTTGGGCAACCATTTCTCGAGAAATGGTTGCCCAAGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025770.3-114s21c1
Sequence:CCGGCATCAGACATTCACAGCAGATCTCGAGATCTGCTGTGAATGTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025770.3-637s21c1
Sequence:CCGGCCAGTGGTTGGTCTGAATTTACTCGAGTAAATTCAGACCAACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025770.3-659s21c1
Sequence:CCGGCTCTGAGCTATGCTAAAGCAACTCGAGTTGCTTTAGCATAGCTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025770.2-78s1c1
Sequence:CCGGCATCAGACATTCACAGCAGATCTCGAGATCTGCTGTGAATGTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025770.2-635s1c1
Sequence:CCGGCTCTGAGCTATGCTAAAGCAACTCGAGTTGCTTTAGCATAGCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025770.2-613s1c1
Sequence:CCGGCCAGTGGTTGGTCTGAATTTACTCGAGTAAATTCAGACCAACCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025770.2-481s1c1
Sequence:CCGGCCAATACTTGGGCAACCATTTCTCGAGAAATGGTTGCCCAAGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031482
VALIDATED
ATG10 MISSION shRNA Bacterial Glycerol Stock
autophagy related 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031482.4-658s21c1
Sequence:CCGGCCTTTAACTCTGAAGGACATACTCGAGTATGTCCTTCAGAGTTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_031482.4-684s21c1
Sequence:CCGGAGGAGTTCATGAGTGCTATAACTCGAGTTATAGCACTCATGAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_031482.4-928s21c1
Sequence:CCGGACGTCTCAGGATGAACGAAATCTCGAGATTTCGTTCATCCTGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031482.4-1570s21c1
Sequence:CCGGGCCAAGTACTTCACTTCCATTCTCGAGAATGGAAGTGAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031482.3-332s1c1
Sequence:CCGGCACAACAGATAGGTGATAGTTCTCGAGAACTATCACCTATCTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031482.3-867s1c1
Sequence:CCGGGCTGAATCTACCTCTGAGTTACTCGAGTAACTCAGAGGTAGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031482.3-530s1c1
Sequence:CCGGCAGCGTCCGAAGTGATTAAATCTCGAGATTTAATCACTTCGGACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031482.3-628s1c1
Sequence:CCGGCCTTTAACTCTGAAGGACATACTCGAGTATGTCCTTCAGAGTTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031482.3-1535s1c1
Sequence:CCGGGCCAAGTACTTCACTTCCATTCTCGAGAATGGAAGTGAAGTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031482
VALIDATED
ATG10 MISSION shRNA shRNA Plasmid DNA
autophagy related 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031482.4-658s21c1
Sequence:CCGGCCTTTAACTCTGAAGGACATACTCGAGTATGTCCTTCAGAGTTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_031482.4-684s21c1
Sequence:CCGGAGGAGTTCATGAGTGCTATAACTCGAGTTATAGCACTCATGAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_031482.4-928s21c1
Sequence:CCGGACGTCTCAGGATGAACGAAATCTCGAGATTTCGTTCATCCTGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031482.4-1570s21c1
Sequence:CCGGGCCAAGTACTTCACTTCCATTCTCGAGAATGGAAGTGAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031482.3-332s1c1
Sequence:CCGGCACAACAGATAGGTGATAGTTCTCGAGAACTATCACCTATCTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031482.3-867s1c1
Sequence:CCGGGCTGAATCTACCTCTGAGTTACTCGAGTAACTCAGAGGTAGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031482.3-530s1c1
Sequence:CCGGCAGCGTCCGAAGTGATTAAATCTCGAGATTTAATCACTTCGGACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031482.3-628s1c1
Sequence:CCGGCCTTTAACTCTGAAGGACATACTCGAGTATGTCCTTCAGAGTTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031482.3-1535s1c1
Sequence:CCGGGCCAAGTACTTCACTTCCATTCTCGAGAATGGAAGTGAAGTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031482
VALIDATED
ATG10 MISSION shRNA Lentiviral Transduction Particles
autophagy related 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031482.4-658s21c1
Sequence:CCGGCCTTTAACTCTGAAGGACATACTCGAGTATGTCCTTCAGAGTTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_031482.4-684s21c1
Sequence:CCGGAGGAGTTCATGAGTGCTATAACTCGAGTTATAGCACTCATGAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_031482.4-928s21c1
Sequence:CCGGACGTCTCAGGATGAACGAAATCTCGAGATTTCGTTCATCCTGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031482.4-1570s21c1
Sequence:CCGGGCCAAGTACTTCACTTCCATTCTCGAGAATGGAAGTGAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031482.3-332s1c1
Sequence:CCGGCACAACAGATAGGTGATAGTTCTCGAGAACTATCACCTATCTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031482.3-867s1c1
Sequence:CCGGGCTGAATCTACCTCTGAGTTACTCGAGTAACTCAGAGGTAGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031482.3-530s1c1
Sequence:CCGGCAGCGTCCGAAGTGATTAAATCTCGAGATTTAATCACTTCGGACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031482.3-628s1c1
Sequence:CCGGCCTTTAACTCTGAAGGACATACTCGAGTATGTCCTTCAGAGTTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031482.3-1535s1c1
Sequence:CCGGGCCAAGTACTTCACTTCCATTCTCGAGAATGGAAGTGAAGTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks