EMAIL THIS PAGE TO A FRIEND

ATG12

autophagy related 12

52 Gene Product Result for
Synonyms: APG12 APG12L FBR93 HAPG12
UniProtKB ID: O94817, Q6PJV2
Gene ID:
Human(9140) Summary: Autophagy is a process of bulk protein degradation in which cytoplasmic components, including organelles, are enclosed in double-membrane structures called autophagosomes and delivered to lysosomes or vacuoles for degradation. ATG12 is the human homolog of a yeast protein involved in autophagy (Mizushima et al., 1998 [PubMed 9852036]
Mouse(67526) autophagy related 12
Rat(361321) autophagy related 12
Zebrafish(570965) ATG12 autophagy related 12 homolog (S. cerevisiae)
chicken(427390) autophagy related 12
fruit fly(39383) Autophagy-specific gene 12
domestic cat(101100938) autophagy related 12
cow(767903) ATG12 autophagy related 12 homolog (S. cerevisiae)
dog(474636) autophagy related 12
sheep(101107357) autophagy related 12
domestic guinea pig(100719707) autophagy related 12
naked mole-rat(101721642) autophagy related 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004707 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004707 Rosetta Predictions human pricing
NM_001038495 Rosetta Predictions rat pricing
NM_026217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161609 predicted 761
2 SASI_Hs01_00161611 predicted 788
3 SASI_Hs01_00161612 predicted 613
4 SASI_Hs01_00161613 predicted 594
5 SASI_Hs01_00161614 predicted 476
6 SASI_Hs01_00161615 predicted 682
7 SASI_Hs01_00161616 predicted 767
8 SASI_Hs02_00338160 predicted 436
9 SASI_Hs02_00338161 predicted 710
10 SASI_Hs01_00161618 predicted 458
11 SASI_Hs01_00161610 predicted 498
12 SASI_Hs01_00161617 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038495 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033163 predicted 306
2 SASI_Rn01_00033164 predicted 403
3 SASI_Rn01_00033165 predicted 839
4 SASI_Rn02_00204673 predicted 694
5 SASI_Rn01_00033166 predicted 931
6 SASI_Rn01_00033167 predicted 687
7 SASI_Rn01_00033168 predicted 447
8 SASI_Rn01_00033169 predicted 593
9 SASI_Rn01_00033170 predicted 896
10 SASI_Rn02_00204674 predicted 632
11 SASI_Rn01_00033162 predicted 785
12 SASI_Rn01_00033171 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176890 predicted 761
2 SASI_Mm02_00329886 predicted 217
3 SASI_Mm01_00176891 predicted 730
4 SASI_Mm01_00176892 predicted 240
5 SASI_Mm01_00176894 predicted 769
6 SASI_Mm02_00329887 predicted 323
7 SASI_Mm01_00176895 predicted 411
8 SASI_Mm01_00176896 predicted 610
9 SASI_Mm01_00176897 predicted 373
10 SASI_Mm01_00176898 predicted 642
11 SASI_Mm01_00176893 predicted 255
12 SASI_Mm01_00176899 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026217
VALIDATED
ATG12 MISSION shRNA Bacterial Glycerol Stock
autophagy related 12
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026217.1-744s1c1
Sequence:CCGGGCACTATGTTAATTCCGTGATCTCGAGATCACGGAATTAACATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026217.1-193s1c1
Sequence:CCGGGCTGTAGGAGACACTCCTATACTCGAGTATAGGAGTGTCTCCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026217.3-414s21c1
Sequence:CCGGTGGTAAACTGGTCCTGCATTACTCGAGTAATGCAGGACCAGTTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026217.3-320s21c1
Sequence:CCGGTGGCCTCGGAACAGTTGTTTACTCGAGTAAACAACTGTTCCGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026217.3-376s21c1
Sequence:CCGGCAAGAAGTTGGAACTCTATATCTCGAGATATAGAGTTCCAACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026217.3-272s21c1
Sequence:CCGGGGACCATCCAAGGACTCATTGCTCGAGCAATGAGTCCTTGGATGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026217.3-770s21c1
Sequence:CCGGACTATGTTAATTCCGTGATAACTCGAGTTATCACGGAATTAACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026217
VALIDATED
ATG12 MISSION shRNA shRNA Plasmid DNA
autophagy related 12
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026217.1-744s1c1
Sequence:CCGGGCACTATGTTAATTCCGTGATCTCGAGATCACGGAATTAACATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026217.1-193s1c1
Sequence:CCGGGCTGTAGGAGACACTCCTATACTCGAGTATAGGAGTGTCTCCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026217.3-414s21c1
Sequence:CCGGTGGTAAACTGGTCCTGCATTACTCGAGTAATGCAGGACCAGTTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026217.3-320s21c1
Sequence:CCGGTGGCCTCGGAACAGTTGTTTACTCGAGTAAACAACTGTTCCGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026217.3-376s21c1
Sequence:CCGGCAAGAAGTTGGAACTCTATATCTCGAGATATAGAGTTCCAACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026217.3-272s21c1
Sequence:CCGGGGACCATCCAAGGACTCATTGCTCGAGCAATGAGTCCTTGGATGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026217.3-770s21c1
Sequence:CCGGACTATGTTAATTCCGTGATAACTCGAGTTATCACGGAATTAACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026217
VALIDATED
ATG12 MISSION shRNA Lentiviral Transduction Particles
autophagy related 12
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026217.1-744s1c1
Sequence:CCGGGCACTATGTTAATTCCGTGATCTCGAGATCACGGAATTAACATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026217.1-193s1c1
Sequence:CCGGGCTGTAGGAGACACTCCTATACTCGAGTATAGGAGTGTCTCCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026217.3-414s21c1
Sequence:CCGGTGGTAAACTGGTCCTGCATTACTCGAGTAATGCAGGACCAGTTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026217.3-320s21c1
Sequence:CCGGTGGCCTCGGAACAGTTGTTTACTCGAGTAAACAACTGTTCCGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026217.3-376s21c1
Sequence:CCGGCAAGAAGTTGGAACTCTATATCTCGAGATATAGAGTTCCAACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026217.3-272s21c1
Sequence:CCGGGGACCATCCAAGGACTCATTGCTCGAGCAATGAGTCCTTGGATGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026217.3-770s21c1
Sequence:CCGGACTATGTTAATTCCGTGATAACTCGAGTTATCACGGAATTAACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004707
VALIDATED
ATG12 MISSION shRNA Bacterial Glycerol Stock
autophagy related 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004707.2-1947s1c1
Sequence:CCGGCGAATGTAATGTGAATGGAATCTCGAGATTCCATTCACATTACATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004707.2-273s1c1
Sequence:CCGGTGTTGCAGCTTCCTACTTCAACTCGAGTTGAAGTAGGAAGCTGCAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004707.2-598s1c1
Sequence:CCGGTGGAACTCTCTATGAGTGTTTCTCGAGAAACACTCATAGAGAGTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004707.2-493s1c1
Sequence:CCGGCCAAGGACTCATTGACTTCATCTCGAGATGAAGTCAATGAGTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004707.2-485s1c1
Sequence:CCGGCGAACCATCCAAGGACTCATTCTCGAGAATGAGTCCTTGGATGGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004707.2-598s21c1
Sequence:CCGGTGGAACTCTCTATGAGTGTTTCTCGAGAAACACTCATAGAGAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004707.2-858s21c1
Sequence:CCGGTTAATGCACCAGTCATCATAACTCGAGTTATGATGACTGGTGCATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004707.2-433s21c1
Sequence:CCGGTGTGGGAGACACTCCTATTATCTCGAGATAATAGGAGTGTCTCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004707.2-273s21c1
Sequence:CCGGTGTTGCAGCTTCCTACTTCAACTCGAGTTGAAGTAGGAAGCTGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004707.2-493s21c1
Sequence:CCGGCCAAGGACTCATTGACTTCATCTCGAGATGAAGTCAATGAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004707
VALIDATED
ATG12 MISSION shRNA shRNA Plasmid DNA
autophagy related 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004707.2-1947s1c1
Sequence:CCGGCGAATGTAATGTGAATGGAATCTCGAGATTCCATTCACATTACATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004707.2-273s1c1
Sequence:CCGGTGTTGCAGCTTCCTACTTCAACTCGAGTTGAAGTAGGAAGCTGCAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004707.2-598s1c1
Sequence:CCGGTGGAACTCTCTATGAGTGTTTCTCGAGAAACACTCATAGAGAGTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004707.2-493s1c1
Sequence:CCGGCCAAGGACTCATTGACTTCATCTCGAGATGAAGTCAATGAGTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004707.2-485s1c1
Sequence:CCGGCGAACCATCCAAGGACTCATTCTCGAGAATGAGTCCTTGGATGGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004707.2-598s21c1
Sequence:CCGGTGGAACTCTCTATGAGTGTTTCTCGAGAAACACTCATAGAGAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004707.2-858s21c1
Sequence:CCGGTTAATGCACCAGTCATCATAACTCGAGTTATGATGACTGGTGCATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004707.2-433s21c1
Sequence:CCGGTGTGGGAGACACTCCTATTATCTCGAGATAATAGGAGTGTCTCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004707.2-273s21c1
Sequence:CCGGTGTTGCAGCTTCCTACTTCAACTCGAGTTGAAGTAGGAAGCTGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004707.2-493s21c1
Sequence:CCGGCCAAGGACTCATTGACTTCATCTCGAGATGAAGTCAATGAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004707
VALIDATED
ATG12 MISSION shRNA Lentiviral Transduction Particles
autophagy related 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004707.2-1947s1c1
Sequence:CCGGCGAATGTAATGTGAATGGAATCTCGAGATTCCATTCACATTACATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004707.2-273s1c1
Sequence:CCGGTGTTGCAGCTTCCTACTTCAACTCGAGTTGAAGTAGGAAGCTGCAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004707.2-598s1c1
Sequence:CCGGTGGAACTCTCTATGAGTGTTTCTCGAGAAACACTCATAGAGAGTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004707.2-493s1c1
Sequence:CCGGCCAAGGACTCATTGACTTCATCTCGAGATGAAGTCAATGAGTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004707.2-485s1c1
Sequence:CCGGCGAACCATCCAAGGACTCATTCTCGAGAATGAGTCCTTGGATGGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004707.2-598s21c1
Sequence:CCGGTGGAACTCTCTATGAGTGTTTCTCGAGAAACACTCATAGAGAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004707.2-858s21c1
Sequence:CCGGTTAATGCACCAGTCATCATAACTCGAGTTATGATGACTGGTGCATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004707.2-433s21c1
Sequence:CCGGTGTGGGAGACACTCCTATTATCTCGAGATAATAGGAGTGTCTCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004707.2-273s21c1
Sequence:CCGGTGTTGCAGCTTCCTACTTCAACTCGAGTTGAAGTAGGAAGCTGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004707.2-493s21c1
Sequence:CCGGCCAAGGACTCATTGACTTCATCTCGAGATGAAGTCAATGAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks