EMAIL THIS PAGE TO A FRIEND

ATG13

autophagy related 13

Synonyms: KIAA0652 PARATARG8
Gene ID:
Mouse(51897) autophagy related 13
Rat(362164) autophagy related 13
Zebrafish(393405) ATG13 autophagy related 13 homolog (S. cerevisiae)
dog(483632) autophagy related 13
domestic cat(101089141) autophagy related 13
Horse(100050734) autophagy related 13
cow(507340) ATG13 autophagy related 13 homolog (S. cerevisiae)
chicken(423192) autophagy related 13
fruit fly(40998) Autophagy-specific gene 13
naked mole-rat(101722321) autophagy related 13
domestic guinea pig(100718839) autophagy related 13
sheep(101115063) autophagy related 13
Domestic Rabbit(100350226) autophagy related 13
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014741 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014741 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014741 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145528 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145528 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145528 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014741 Rosetta Predictions human pricing
XM_001069036 Rosetta Predictions rat pricing
XM_342465 Rosetta Predictions rat pricing
NM_145528 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147812 predicted 1455
2 SASI_Hs01_00147813 predicted 1591
3 SASI_Hs01_00147814 predicted 1108
4 SASI_Hs01_00147815 predicted 1435
5 SASI_Hs01_00147818 predicted 1708
6 SASI_Hs01_00147820 predicted 1706
7 SASI_Hs02_00346201 predicted 1869
8 SASI_Hs01_00147821 predicted 1018
9 SASI_Hs02_00346202 predicted 614
10 SASI_Hs02_00346203 predicted 955
11 SASI_Hs01_00147816 predicted 743
12 SASI_Hs01_00147817 predicted 792
13 SASI_Hs01_00147819 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326698 predicted 905
2 SASI_Rn02_00326699 predicted 1207
3 SASI_Rn02_00326700 predicted 1676
4 SASI_Rn02_00326701 predicted 1478
5 SASI_Rn02_00326702 predicted 1202
6 SASI_Rn02_00326703 predicted 1671
7 SASI_Rn02_00326704 predicted 583
8 SASI_Rn02_00326705 predicted 1488
9 SASI_Rn02_00326706 predicted 923
10 SASI_Rn02_00326707 predicted 1715
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394299 predicted 908
2 SASI_Rn02_00394300 predicted 1207
3 SASI_Rn02_00394301 predicted 1676
4 SASI_Rn02_00394302 predicted 1479
5 SASI_Rn02_00394303 predicted 1196
6 SASI_Rn02_00394304 predicted 1668
7 SASI_Rn02_00394305 predicted 584
8 SASI_Rn02_00394306 predicted 1490
9 SASI_Rn02_00394307 predicted 917
10 SASI_Rn02_00394308 predicted 1723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145528 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117661 predicted 667
2 SASI_Mm01_00117662 predicted 891
3 SASI_Mm01_00117663 predicted 1347
4 SASI_Mm01_00117664 predicted 910
5 SASI_Mm01_00117666 predicted 623
6 SASI_Mm02_00341009 predicted 1555
7 SASI_Mm01_00117667 predicted 1682
8 SASI_Mm01_00117668 predicted 1362
9 SASI_Mm01_00117669 predicted 814
10 SASI_Mm01_00117670 predicted 594
11 SASI_Mm01_00117665 predicted 503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014741
VALIDATED
ATG13 MISSION shRNA Bacterial Glycerol Stock
autophagy related 13
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014741.3-2259s21c1
Sequence:CCGGGACCCAGAAGTCCCTACTCTTCTCGAGAAGAGTAGGGACTTCTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014741.3-1058s21c1
Sequence:CCGGTGAAGTCCCTTCTTGCTATAACTCGAGTTATAGCAAGAAGGGACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014741.3-1964s21c1
Sequence:CCGGGGACCTTCTATCGGGAGTTTCCTCGAGGAAACTCCCGATAGAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014741.2-1779s1c1
Sequence:CCGGGAGAAGAATGTCCGCGAGTTTCTCGAGAAACTCGCGGACATTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014741.2-3228s1c1
Sequence:CCGGCCCACCTATGATCTGTCCTTTCTCGAGAAAGGACAGATCATAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014741.2-1455s1c1
Sequence:CCGGGCCATGTTTGCTCCCAAGAATCTCGAGATTCTTGGGAGCAAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014741.2-417s1c1
Sequence:CCGGGACCTGGACAAGTTTATTAAACTCGAGTTTAATAAACTTGTCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014741
VALIDATED
ATG13 MISSION shRNA shRNA Plasmid DNA
autophagy related 13
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014741.3-2259s21c1
Sequence:CCGGGACCCAGAAGTCCCTACTCTTCTCGAGAAGAGTAGGGACTTCTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014741.3-1058s21c1
Sequence:CCGGTGAAGTCCCTTCTTGCTATAACTCGAGTTATAGCAAGAAGGGACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014741.3-1964s21c1
Sequence:CCGGGGACCTTCTATCGGGAGTTTCCTCGAGGAAACTCCCGATAGAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014741.2-1779s1c1
Sequence:CCGGGAGAAGAATGTCCGCGAGTTTCTCGAGAAACTCGCGGACATTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014741.2-3228s1c1
Sequence:CCGGCCCACCTATGATCTGTCCTTTCTCGAGAAAGGACAGATCATAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014741.2-1455s1c1
Sequence:CCGGGCCATGTTTGCTCCCAAGAATCTCGAGATTCTTGGGAGCAAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014741.2-417s1c1
Sequence:CCGGGACCTGGACAAGTTTATTAAACTCGAGTTTAATAAACTTGTCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014741
VALIDATED
ATG13 MISSION shRNA Lentiviral Transduction Particles
autophagy related 13
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014741.3-2259s21c1
Sequence:CCGGGACCCAGAAGTCCCTACTCTTCTCGAGAAGAGTAGGGACTTCTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014741.3-1058s21c1
Sequence:CCGGTGAAGTCCCTTCTTGCTATAACTCGAGTTATAGCAAGAAGGGACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014741.3-1964s21c1
Sequence:CCGGGGACCTTCTATCGGGAGTTTCCTCGAGGAAACTCCCGATAGAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014741.2-1779s1c1
Sequence:CCGGGAGAAGAATGTCCGCGAGTTTCTCGAGAAACTCGCGGACATTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014741.2-3228s1c1
Sequence:CCGGCCCACCTATGATCTGTCCTTTCTCGAGAAAGGACAGATCATAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014741.2-1455s1c1
Sequence:CCGGGCCATGTTTGCTCCCAAGAATCTCGAGATTCTTGGGAGCAAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014741.2-417s1c1
Sequence:CCGGGACCTGGACAAGTTTATTAAACTCGAGTTTAATAAACTTGTCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145528
VALIDATED
ATG13 MISSION shRNA Bacterial Glycerol Stock
autophagy related 13
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145528.2-2035s21c1
Sequence:CCGGGTCCTCAGCTGCTTCACAAAGCTCGAGCTTTGTGAAGCAGCTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145528.2-574s1c1
Sequence:CCGGGCGATCTATGTGTGTGGAAATCTCGAGATTTCCACACACATAGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145528.2-717s21c1
Sequence:CCGGTGAAGTCTCTTCTCGCTATTACTCGAGTAATAGCGAGAAGAGACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145528.2-1400s21c1
Sequence:CCGGGACATACCTTTCGCCATGTTTCTCGAGAAACATGGCGAAAGGTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145528.2-1445s21c1
Sequence:CCGGGATGCTGATCCTATGGTGAATCTCGAGATTCACCATAGGATCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145528.2-1555s21c1
Sequence:CCGGCGACTTTGTTATGATTGACTTCTCGAGAAGTCAATCATAACAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145528.1-1694s1c1
Sequence:CCGGGCGGAAGATTTGGACTCCTTACTCGAGTAAGGAGTCCAAATCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145528.1-716s1c1
Sequence:CCGGCTGAAGTCTCTTCTCGCTATTCTCGAGAATAGCGAGAAGAGACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145528.1-1445s1c1
Sequence:CCGGGATGCTGATCCTATGGTGAATCTCGAGATTCACCATAGGATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145528.1-1400s1c1
Sequence:CCGGGACATACCTTTCGCCATGTTTCTCGAGAAACATGGCGAAAGGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145528.1-905s1c1
Sequence:CCGGGCTTATAGAATTAACTTGGCACTCGAGTGCCAAGTTAATTCTATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145528
VALIDATED
ATG13 MISSION shRNA shRNA Plasmid DNA
autophagy related 13
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145528.2-2035s21c1
Sequence:CCGGGTCCTCAGCTGCTTCACAAAGCTCGAGCTTTGTGAAGCAGCTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145528.2-574s1c1
Sequence:CCGGGCGATCTATGTGTGTGGAAATCTCGAGATTTCCACACACATAGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145528.2-717s21c1
Sequence:CCGGTGAAGTCTCTTCTCGCTATTACTCGAGTAATAGCGAGAAGAGACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145528.2-1400s21c1
Sequence:CCGGGACATACCTTTCGCCATGTTTCTCGAGAAACATGGCGAAAGGTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145528.2-1445s21c1
Sequence:CCGGGATGCTGATCCTATGGTGAATCTCGAGATTCACCATAGGATCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145528.2-1555s21c1
Sequence:CCGGCGACTTTGTTATGATTGACTTCTCGAGAAGTCAATCATAACAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145528.1-1694s1c1
Sequence:CCGGGCGGAAGATTTGGACTCCTTACTCGAGTAAGGAGTCCAAATCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145528.1-716s1c1
Sequence:CCGGCTGAAGTCTCTTCTCGCTATTCTCGAGAATAGCGAGAAGAGACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145528.1-1445s1c1
Sequence:CCGGGATGCTGATCCTATGGTGAATCTCGAGATTCACCATAGGATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145528.1-1400s1c1
Sequence:CCGGGACATACCTTTCGCCATGTTTCTCGAGAAACATGGCGAAAGGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145528.1-905s1c1
Sequence:CCGGGCTTATAGAATTAACTTGGCACTCGAGTGCCAAGTTAATTCTATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145528
VALIDATED
ATG13 MISSION shRNA Lentiviral Transduction Particles
autophagy related 13
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145528.2-2035s21c1
Sequence:CCGGGTCCTCAGCTGCTTCACAAAGCTCGAGCTTTGTGAAGCAGCTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145528.2-574s1c1
Sequence:CCGGGCGATCTATGTGTGTGGAAATCTCGAGATTTCCACACACATAGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145528.2-717s21c1
Sequence:CCGGTGAAGTCTCTTCTCGCTATTACTCGAGTAATAGCGAGAAGAGACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145528.2-1400s21c1
Sequence:CCGGGACATACCTTTCGCCATGTTTCTCGAGAAACATGGCGAAAGGTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145528.2-1445s21c1
Sequence:CCGGGATGCTGATCCTATGGTGAATCTCGAGATTCACCATAGGATCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145528.2-1555s21c1
Sequence:CCGGCGACTTTGTTATGATTGACTTCTCGAGAAGTCAATCATAACAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145528.1-1694s1c1
Sequence:CCGGGCGGAAGATTTGGACTCCTTACTCGAGTAAGGAGTCCAAATCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145528.1-716s1c1
Sequence:CCGGCTGAAGTCTCTTCTCGCTATTCTCGAGAATAGCGAGAAGAGACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145528.1-1445s1c1
Sequence:CCGGGATGCTGATCCTATGGTGAATCTCGAGATTCACCATAGGATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145528.1-1400s1c1
Sequence:CCGGGACATACCTTTCGCCATGTTTCTCGAGAAACATGGCGAAAGGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145528.1-905s1c1
Sequence:CCGGGCTTATAGAATTAACTTGGCACTCGAGTGCCAAGTTAATTCTATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks