EMAIL THIS PAGE TO A FRIEND

ATG14

autophagy related 14

93 Gene Product Result for
Synonyms: ATG14L BARKOR KIAA0831
Gene ID:
Mouse(100504663) autophagy related 14
Rat(305831) autophagy related 14
sheep(101119220) autophagy related 14
Domestic Rabbit(100357931) autophagy related 14
domestic guinea pig(100726400) autophagy related 14
naked mole-rat(101723970) autophagy related 14
chicken(428922) autophagy related 14
domestic cat(101092860) autophagy related 14
cow(538831) ATG14 autophagy related 14 homolog (S. cerevisiae)
Horse(100050443) autophagy related 14
dog(490704) autophagy related 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014924 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_375080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375080 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132031 MISSION® esiRNA esiRNA human KIAA0831 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014924 Rosetta Predictions human pricing
NM_001107258 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147622 predicted 378
2 SASI_Hs01_00147623 predicted 270
3 SASI_Hs01_00147624 predicted 543
4 SASI_Hs01_00147625 predicted 1046
5 SASI_Hs01_00147626 predicted 1531
6 SASI_Hs01_00147627 predicted 963
7 SASI_Hs01_00147628 predicted 982
8 SASI_Hs01_00147629 predicted 817
9 SASI_Hs01_00147630 predicted 835
10 SASI_Hs02_00346572 predicted 1508
11 SASI_Hs01_00147631 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227065 predicted 261
2 SASI_Rn02_00227066 predicted 601
3 SASI_Rn02_00227067 predicted 848
4 SASI_Rn02_00227068 predicted 1093
5 SASI_Rn02_00227069 predicted 823
6 SASI_Rn02_00227070 predicted 1117
7 SASI_Rn02_00227071 predicted 588
8 SASI_Rn02_00227072 predicted 517
9 SASI_Rn02_00227073 predicted 379
10 SASI_Rn02_00227074 predicted 902
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014924
VALIDATED
ATG14 MISSION shRNA Bacterial Glycerol Stock
autophagy related 14
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014924.3-1135s1c1
Sequence:CCGGGATCAATTACAACCACTGCATCTCGAGATGCAGTGGTTGTAATTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_014924.3-4360s1c1
Sequence:CCGGCCATAGAACTTGGTCATGTTTCTCGAGAAACATGACCAAGTTCTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014924.3-523s1c1
Sequence:CCGGGAGAAGATTCAGAGGCATAATCTCGAGATTATGCCTCTGAATCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014924.3-2431s1c1
Sequence:CCGGCCACTTTCTTTCTATGGGATTCTCGAGAATCCCATAGAAAGAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014924.3-815s1c1
Sequence:CCGGGCATTAGCATTACAGGGCCTTCTCGAGAAGGCCCTGTAATGCTAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014924.3-1279s1c1
Sequence:CCGGGAATCAGATGAGAGCGGAGATCTCGAGATCTCCGCTCTCATCTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014924.3-602s1c1
Sequence:CCGGGTCTGGCAAATCTTCGACGATCTCGAGATCGTCGAAGATTTGCCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014924.3-608s1c1
Sequence:CCGGCAAATCTTCGACGATCCCATACTCGAGTATGGGATCGTCGAAGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014924.3-1158s1c1
Sequence:CCGGCCTCAGGAATCTAATGTACCTCTCGAGAGGTACATTAGATTCCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014924.3-1135s21c1
Sequence:CCGGGATCAATTACAACCACTGCATCTCGAGATGCAGTGGTTGTAATTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014924.3-1279s21c1
Sequence:CCGGGAATCAGATGAGAGCGGAGATCTCGAGATCTCCGCTCTCATCTGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014924.3-1078s21c1
Sequence:CCGGGTGAAGAAACTGAATGCAAATCTCGAGATTTGCATTCAGTTTCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014924.3-608s21c1
Sequence:CCGGCAAATCTTCGACGATCCCATACTCGAGTATGGGATCGTCGAAGATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014924
VALIDATED
ATG14 MISSION shRNA shRNA Plasmid DNA
autophagy related 14
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014924.3-1135s1c1
Sequence:CCGGGATCAATTACAACCACTGCATCTCGAGATGCAGTGGTTGTAATTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_014924.3-4360s1c1
Sequence:CCGGCCATAGAACTTGGTCATGTTTCTCGAGAAACATGACCAAGTTCTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014924.3-523s1c1
Sequence:CCGGGAGAAGATTCAGAGGCATAATCTCGAGATTATGCCTCTGAATCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014924.3-2431s1c1
Sequence:CCGGCCACTTTCTTTCTATGGGATTCTCGAGAATCCCATAGAAAGAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014924.3-815s1c1
Sequence:CCGGGCATTAGCATTACAGGGCCTTCTCGAGAAGGCCCTGTAATGCTAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014924.3-1279s1c1
Sequence:CCGGGAATCAGATGAGAGCGGAGATCTCGAGATCTCCGCTCTCATCTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014924.3-602s1c1
Sequence:CCGGGTCTGGCAAATCTTCGACGATCTCGAGATCGTCGAAGATTTGCCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014924.3-608s1c1
Sequence:CCGGCAAATCTTCGACGATCCCATACTCGAGTATGGGATCGTCGAAGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014924.3-1158s1c1
Sequence:CCGGCCTCAGGAATCTAATGTACCTCTCGAGAGGTACATTAGATTCCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014924.3-1135s21c1
Sequence:CCGGGATCAATTACAACCACTGCATCTCGAGATGCAGTGGTTGTAATTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014924.3-1279s21c1
Sequence:CCGGGAATCAGATGAGAGCGGAGATCTCGAGATCTCCGCTCTCATCTGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014924.3-1078s21c1
Sequence:CCGGGTGAAGAAACTGAATGCAAATCTCGAGATTTGCATTCAGTTTCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014924.3-608s21c1
Sequence:CCGGCAAATCTTCGACGATCCCATACTCGAGTATGGGATCGTCGAAGATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014924
VALIDATED
ATG14 MISSION shRNA Lentiviral Transduction Particles
autophagy related 14
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014924.3-1135s1c1
Sequence:CCGGGATCAATTACAACCACTGCATCTCGAGATGCAGTGGTTGTAATTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_014924.3-4360s1c1
Sequence:CCGGCCATAGAACTTGGTCATGTTTCTCGAGAAACATGACCAAGTTCTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014924.3-523s1c1
Sequence:CCGGGAGAAGATTCAGAGGCATAATCTCGAGATTATGCCTCTGAATCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014924.3-2431s1c1
Sequence:CCGGCCACTTTCTTTCTATGGGATTCTCGAGAATCCCATAGAAAGAAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014924.3-815s1c1
Sequence:CCGGGCATTAGCATTACAGGGCCTTCTCGAGAAGGCCCTGTAATGCTAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014924.3-1279s1c1
Sequence:CCGGGAATCAGATGAGAGCGGAGATCTCGAGATCTCCGCTCTCATCTGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014924.3-602s1c1
Sequence:CCGGGTCTGGCAAATCTTCGACGATCTCGAGATCGTCGAAGATTTGCCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014924.3-608s1c1
Sequence:CCGGCAAATCTTCGACGATCCCATACTCGAGTATGGGATCGTCGAAGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014924.3-1158s1c1
Sequence:CCGGCCTCAGGAATCTAATGTACCTCTCGAGAGGTACATTAGATTCCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014924.3-1135s21c1
Sequence:CCGGGATCAATTACAACCACTGCATCTCGAGATGCAGTGGTTGTAATTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014924.3-1279s21c1
Sequence:CCGGGAATCAGATGAGAGCGGAGATCTCGAGATCTCCGCTCTCATCTGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014924.3-1078s21c1
Sequence:CCGGGTGAAGAAACTGAATGCAAATCTCGAGATTTGCATTCAGTTTCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014924.3-608s21c1
Sequence:CCGGCAAATCTTCGACGATCCCATACTCGAGTATGGGATCGTCGAAGATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375080
VALIDATED
ATG14 MISSION shRNA Bacterial Glycerol Stock
autophagy related 14
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000122876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_375080.1-232s1c1
Sequence:CCGGGCAAATCTTCGACGATCCCATCTCGAGATGGGATCGTCGAAGATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_375080.1-703s1c1
Sequence:CCGGGTGAAGAAACTGAATGCAAATCTCGAGATTTGCATTCAGTTTCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375080.1-2535s1c1
Sequence:CCGGGCCTCTTATGAAACCATGAATCTCGAGATTCATGGTTTCATAAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375080
VALIDATED
ATG14 MISSION shRNA shRNA Plasmid DNA
autophagy related 14
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000122876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_375080.1-232s1c1
Sequence:CCGGGCAAATCTTCGACGATCCCATCTCGAGATGGGATCGTCGAAGATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_375080.1-703s1c1
Sequence:CCGGGTGAAGAAACTGAATGCAAATCTCGAGATTTGCATTCAGTTTCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375080.1-2535s1c1
Sequence:CCGGGCCTCTTATGAAACCATGAATCTCGAGATTCATGGTTTCATAAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375080
VALIDATED
ATG14 MISSION shRNA Lentiviral Transduction Particles
autophagy related 14
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000122876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_375080.1-232s1c1
Sequence:CCGGGCAAATCTTCGACGATCCCATCTCGAGATGGGATCGTCGAAGATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_375080.1-703s1c1
Sequence:CCGGGTGAAGAAACTGAATGCAAATCTCGAGATTTGCATTCAGTTTCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375080.1-2535s1c1
Sequence:CCGGGCCTCTTATGAAACCATGAATCTCGAGATTCATGGTTTCATAAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)