EMAIL THIS PAGE TO A FRIEND

ATG16L1

autophagy related 16-like 1 (S. cerevisiae)

90 Gene Product Result for
Synonyms: APG16L ATG16A ATG16L IBD10 WDR30
Gene ID:
Human(55054) Summary: The protein encoded by this gene is part of a large protein complex that is necessary for autophagy, the major process by which intracellular components are targeted to lysosomes for degradation. Defects in this gene are a cause of susceptibility to inflammatory bowel disease type 10 (IBD10). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
Mouse(77040) autophagy related 16-like 1 (S. cerevisiae)
Rat(363278) autophagy related 16-like 1 (S. cerevisiae)
Zebrafish(550552) ATG16 autophagy related 16-like 1 (S. cerevisiae)
cow(509587) ATG16 autophagy related 16-like 1 (S. cerevisiae)
domestic cat(101100748) autophagy related 16-like 1 (S. cerevisiae)
dog(477412) autophagy related 16-like 1 (S. cerevisiae)
chicken(424746) autophagy related 16-like 1 (S. cerevisiae)
naked mole-rat(101715799) autophagy related 16-like 1 (S. cerevisiae)
domestic guinea pig(100722464) autophagy related 16-like 1 (S. cerevisiae)
sheep(101112693) autophagy related 16-like 1 (S. cerevisiae)
Domestic Rabbit(100345122) autophagy related 16-like 1 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500317 Anti-ATG16 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
A7356 Anti-Atg16L antibody produced in rabbit fractionated antiserum, buffered aqueous solution rat, human, mouse
western blot pricing
SAB1305644 ANTI-ATG16L antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1306270 ANTI-ATG16L(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1305643 ANTI-ATG16L(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2108635 Anti-ATG16L1 affinity isolated antibody human, guinea pig, pig, mouse, bovine, canine, horse, bovine, rabbit
western blot pricing
AV54268 Anti-ATG16L1 (AB1) antibody produced in rabbit affinity isolated antibody bovine, rat, pig, human, mouse, rabbit, canine, guinea pig
western blot pricing
AV54272 Anti-ATG16L1 (AB2) antibody produced in rabbit affinity isolated antibody rabbit, rat, human, guinea pig, canine, mouse, bovine, pig, horse
western blot pricing
SAB2501677 Anti-ATG16L1 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, rat, human, mouse
ELISA, western blot pricing
SAB1407607 Anti-ATG16L1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA012577 Anti-ATG16L1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2103567 Anti-ATG16L1 antibody produced in rabbit affinity isolated antibody canine, guinea pig, pig, human, rat, horse, bovine, mouse, rabbit
western blot pricing
HPA063900 Anti-ATG16L1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1305576 ANTI-PHOSPHO-ATG16L(S287) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030803 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030803 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030803 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029846 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029846 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029846 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017974 Rosetta Predictions human pricing
NM_030803 Rosetta Predictions human pricing
NM_198890 Rosetta Predictions human pricing
NM_001108809 Rosetta Predictions rat pricing
NM_029846 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351011 predicted 485
2 SASI_Hs02_00351012 predicted 700
3 SASI_Hs01_00023674 predicted 1534
4 SASI_Hs01_00023675 predicted 1617
5 SASI_Hs02_00351013 predicted 1617
6 SASI_Hs02_00351014 predicted 697
7 SASI_Hs02_00351015 predicted 1434
8 SASI_Hs01_00023677 predicted 1336
9 SASI_Hs01_00023678 predicted 1863
10 SASI_Hs02_00351016 predicted 530
11 SASI_Hs01_00023673 predicted 1259
12 SASI_Hs01_00023676 predicted 1188
13 SASI_Hs01_00023679 predicted 1673
14 SASI_Hs01_00023680 predicted 1229
15 SASI_Hs01_00023681 predicted 1417
16 SASI_Hs01_00023682 predicted 1212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358367 predicted 482
2 SASI_Hs02_00358368 predicted 700
3 SASI_Hs01_00234807 predicted 1583
4 SASI_Hs01_00234808 predicted 1672
5 SASI_Hs02_00358369 predicted 1672
6 SASI_Hs02_00358370 predicted 700
7 SASI_Hs02_00358371 predicted 1494
8 SASI_Hs01_00234810 predicted 1388
9 SASI_Hs01_00234811 predicted 1923
10 SASI_Hs02_00358372 predicted 534
11 SASI_Hs01_00234806 predicted 1316
12 SASI_Hs01_00234809 predicted 1236
13 SASI_Hs01_00234812 predicted 1729
14 SASI_Hs01_00234813 predicted 1289
15 SASI_Hs01_00234814 predicted 1476
16 SASI_Hs01_00234815 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165923 predicted 884
2 SASI_Hs01_00165924 predicted 1077
3 SASI_Hs01_00165925 predicted 1164
4 SASI_Hs01_00165926 predicted 800
5 SASI_Hs01_00165927 predicted 873
6 SASI_Hs01_00165928 predicted 1411
7 SASI_Hs01_00165929 predicted 1288
8 SASI_Hs01_00165930 predicted 850
9 SASI_Hs01_00165931 predicted 1043
10 SASI_Hs01_00165932 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108809 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242285 predicted 892
2 SASI_Rn02_00242286 predicted 592
3 SASI_Rn02_00242287 predicted 941
4 SASI_Rn02_00242288 predicted 1140
5 SASI_Rn02_00242289 predicted 823
6 SASI_Rn02_00242290 predicted 1881
7 SASI_Rn02_00242291 predicted 376
8 SASI_Rn02_00242292 predicted 1190
9 SASI_Rn02_00242293 predicted 1800
10 SASI_Rn02_00242294 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181794 predicted 1228
2 SASI_Mm01_00181795 predicted 442
3 SASI_Mm01_00181796 predicted 1260
4 SASI_Mm01_00181797 predicted 956
5 SASI_Mm01_00181798 predicted 1211
6 SASI_Mm01_00181799 predicted 1185
7 SASI_Mm01_00181801 predicted 1672
8 SASI_Mm01_00181802 predicted 436
9 SASI_Mm01_00181803 predicted 854
10 SASI_Mm02_00336051 predicted 1052
11 SASI_Mm01_00181800 predicted 1797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030803
ATG16L1 MISSION shRNA Bacterial Glycerol Stock
autophagy related 16-like 1 (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030803.6-1727s21c1
Sequence:CCGGGATTACTGCCCTGGACTTAAACTCGAGTTTAAGTCCAGGGCAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030803.6-1602s21c1
Sequence:CCGGGGATCCAGTTGCAATGATATTCTCGAGAATATCATTGCAACTGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030803.6-1377s21c1
Sequence:CCGGTTTGATAGTGCTGGATCTTACCTCGAGGTAAGATCCAGCACTATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030803.6-2212s21c1
Sequence:CCGGACTGTAGCTTTGCCGTGAATGCTCGAGCATTCACGGCAAAGCTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030803.5-770s1c1
Sequence:CCGGCAGGAAGCCAATCGGCTTAATCTCGAGATTAAGCCGATTGGCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030803.5-511s1c1
Sequence:CCGGGAATAACCAAATGCAGCGGAACTCGAGTTCCGCTGCATTTGGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030803.5-533s1c1
Sequence:CCGGGACAGGGAGATGCAGATGAATCTCGAGATTCATCTGCATCTCCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030803.5-994s1c1
Sequence:CCGGCCTTCTGGATTCTATCACTAACTCGAGTTAGTGATAGAATCCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030803.5-1550s1c1
Sequence:CCGGCAATGTGTAATGAGTGGACATCTCGAGATGTCCACTCATTACACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136626    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030803.5-2181s1c1
Sequence:CCGGGCCTGGAAGAATAACACTGAACTCGAGTTCAGTGTTATTCTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030803.5-2412s1c1
Sequence:CCGGCCCAACACCTTGGGTTCATTTCTCGAGAAATGAACCCAAGGTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030803
ATG16L1 MISSION shRNA shRNA Plasmid DNA
autophagy related 16-like 1 (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030803.6-1727s21c1
Sequence:CCGGGATTACTGCCCTGGACTTAAACTCGAGTTTAAGTCCAGGGCAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030803.6-1602s21c1
Sequence:CCGGGGATCCAGTTGCAATGATATTCTCGAGAATATCATTGCAACTGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030803.6-1377s21c1
Sequence:CCGGTTTGATAGTGCTGGATCTTACCTCGAGGTAAGATCCAGCACTATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030803.6-2212s21c1
Sequence:CCGGACTGTAGCTTTGCCGTGAATGCTCGAGCATTCACGGCAAAGCTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030803.5-770s1c1
Sequence:CCGGCAGGAAGCCAATCGGCTTAATCTCGAGATTAAGCCGATTGGCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030803.5-511s1c1
Sequence:CCGGGAATAACCAAATGCAGCGGAACTCGAGTTCCGCTGCATTTGGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030803.5-533s1c1
Sequence:CCGGGACAGGGAGATGCAGATGAATCTCGAGATTCATCTGCATCTCCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030803.5-994s1c1
Sequence:CCGGCCTTCTGGATTCTATCACTAACTCGAGTTAGTGATAGAATCCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030803.5-1550s1c1
Sequence:CCGGCAATGTGTAATGAGTGGACATCTCGAGATGTCCACTCATTACACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136626    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030803.5-2181s1c1
Sequence:CCGGGCCTGGAAGAATAACACTGAACTCGAGTTCAGTGTTATTCTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030803.5-2412s1c1
Sequence:CCGGCCCAACACCTTGGGTTCATTTCTCGAGAAATGAACCCAAGGTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030803
ATG16L1 MISSION shRNA Lentiviral Transduction Particles
autophagy related 16-like 1 (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030803.6-1727s21c1
Sequence:CCGGGATTACTGCCCTGGACTTAAACTCGAGTTTAAGTCCAGGGCAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030803.6-1602s21c1
Sequence:CCGGGGATCCAGTTGCAATGATATTCTCGAGAATATCATTGCAACTGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030803.6-1377s21c1
Sequence:CCGGTTTGATAGTGCTGGATCTTACCTCGAGGTAAGATCCAGCACTATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030803.6-2212s21c1
Sequence:CCGGACTGTAGCTTTGCCGTGAATGCTCGAGCATTCACGGCAAAGCTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030803.5-770s1c1
Sequence:CCGGCAGGAAGCCAATCGGCTTAATCTCGAGATTAAGCCGATTGGCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030803.5-511s1c1
Sequence:CCGGGAATAACCAAATGCAGCGGAACTCGAGTTCCGCTGCATTTGGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030803.5-533s1c1
Sequence:CCGGGACAGGGAGATGCAGATGAATCTCGAGATTCATCTGCATCTCCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030803.5-994s1c1
Sequence:CCGGCCTTCTGGATTCTATCACTAACTCGAGTTAGTGATAGAATCCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030803.5-1550s1c1
Sequence:CCGGCAATGTGTAATGAGTGGACATCTCGAGATGTCCACTCATTACACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136626    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030803.5-2181s1c1
Sequence:CCGGGCCTGGAAGAATAACACTGAACTCGAGTTCAGTGTTATTCTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030803.5-2412s1c1
Sequence:CCGGCCCAACACCTTGGGTTCATTTCTCGAGAAATGAACCCAAGGTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029846
VALIDATED
ATG16L1 MISSION shRNA Bacterial Glycerol Stock
autophagy related 16-like 1 (S. cerevisiae)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029846.3-218s21c1
Sequence:CCGGAGGCGTTCGAGGAGATCATTCCTCGAGGAATGATCTCCTCGAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029846.3-952s21c1
Sequence:CCGGCTTCTGGATTCTATCACTAATCTCGAGATTAGTGATAGAATCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029846.3-2123s21c1
Sequence:CCGGCCCTAGCAGAGGTTCAGATTTCTCGAGAAATCTGAACCTCTGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029846.3-1174s21c1
Sequence:CCGGTGGGAAGCATTCGGAGATAAACTCGAGTTTATCTCCGAATGCTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029846.3-1669s21c1
Sequence:CCGGGTCATCGACCTCCGGACAAATCTCGAGATTTGTCCGGAGGTCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029846.2-2043s1c1
Sequence:CCGGCCGTAGCTTTCTTGAGAACTTCTCGAGAAGTTCTCAAGAAAGCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029846.2-1479s1c1
Sequence:CCGGCCAGCTGCAATGACATTGTTTCTCGAGAAACAATGTCATTGCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029846.2-2044s1c1
Sequence:CCGGCGTAGCTTTCTTGAGAACTTTCTCGAGAAAGTTCTCAAGAAAGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175371    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029846.2-2286s1c1
Sequence:CCGGCCCATCTTTCCAAAGTCTGTTCTCGAGAACAGACTTTGGAAAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029846.2-821s1c1
Sequence:CCGGCCTCTACCTGTTGAACAGGATCTCGAGATCCTGTTCAACAGGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029846.2-1574s1c1
Sequence:CCGGGTCCGAGAGATGGAACTGTTACTCGAGTAACAGTTCCATCTCTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029846.2-356s1c1
Sequence:CCGGGCGTGGAATGATAGTCAACTACTCGAGTAGTTGACTATCATTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029846
VALIDATED
ATG16L1 MISSION shRNA shRNA Plasmid DNA
autophagy related 16-like 1 (S. cerevisiae)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029846.3-218s21c1
Sequence:CCGGAGGCGTTCGAGGAGATCATTCCTCGAGGAATGATCTCCTCGAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029846.3-952s21c1
Sequence:CCGGCTTCTGGATTCTATCACTAATCTCGAGATTAGTGATAGAATCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029846.3-2123s21c1
Sequence:CCGGCCCTAGCAGAGGTTCAGATTTCTCGAGAAATCTGAACCTCTGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029846.3-1174s21c1
Sequence:CCGGTGGGAAGCATTCGGAGATAAACTCGAGTTTATCTCCGAATGCTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029846.3-1669s21c1
Sequence:CCGGGTCATCGACCTCCGGACAAATCTCGAGATTTGTCCGGAGGTCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029846.2-2043s1c1
Sequence:CCGGCCGTAGCTTTCTTGAGAACTTCTCGAGAAGTTCTCAAGAAAGCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029846.2-1479s1c1
Sequence:CCGGCCAGCTGCAATGACATTGTTTCTCGAGAAACAATGTCATTGCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029846.2-2044s1c1
Sequence:CCGGCGTAGCTTTCTTGAGAACTTTCTCGAGAAAGTTCTCAAGAAAGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175371    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029846.2-2286s1c1
Sequence:CCGGCCCATCTTTCCAAAGTCTGTTCTCGAGAACAGACTTTGGAAAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029846.2-821s1c1
Sequence:CCGGCCTCTACCTGTTGAACAGGATCTCGAGATCCTGTTCAACAGGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029846.2-1574s1c1
Sequence:CCGGGTCCGAGAGATGGAACTGTTACTCGAGTAACAGTTCCATCTCTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029846.2-356s1c1
Sequence:CCGGGCGTGGAATGATAGTCAACTACTCGAGTAGTTGACTATCATTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029846
VALIDATED
ATG16L1 MISSION shRNA Lentiviral Transduction Particles
autophagy related 16-like 1 (S. cerevisiae)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029846.3-218s21c1
Sequence:CCGGAGGCGTTCGAGGAGATCATTCCTCGAGGAATGATCTCCTCGAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029846.3-952s21c1
Sequence:CCGGCTTCTGGATTCTATCACTAATCTCGAGATTAGTGATAGAATCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029846.3-2123s21c1
Sequence:CCGGCCCTAGCAGAGGTTCAGATTTCTCGAGAAATCTGAACCTCTGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029846.3-1174s21c1
Sequence:CCGGTGGGAAGCATTCGGAGATAAACTCGAGTTTATCTCCGAATGCTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029846.3-1669s21c1
Sequence:CCGGGTCATCGACCTCCGGACAAATCTCGAGATTTGTCCGGAGGTCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029846.2-2043s1c1
Sequence:CCGGCCGTAGCTTTCTTGAGAACTTCTCGAGAAGTTCTCAAGAAAGCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029846.2-1479s1c1
Sequence:CCGGCCAGCTGCAATGACATTGTTTCTCGAGAAACAATGTCATTGCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029846.2-2044s1c1
Sequence:CCGGCGTAGCTTTCTTGAGAACTTTCTCGAGAAAGTTCTCAAGAAAGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175371    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029846.2-2286s1c1
Sequence:CCGGCCCATCTTTCCAAAGTCTGTTCTCGAGAACAGACTTTGGAAAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029846.2-821s1c1
Sequence:CCGGCCTCTACCTGTTGAACAGGATCTCGAGATCCTGTTCAACAGGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029846.2-1574s1c1
Sequence:CCGGGTCCGAGAGATGGAACTGTTACTCGAGTAACAGTTCCATCTCTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029846.2-356s1c1
Sequence:CCGGGCGTGGAATGATAGTCAACTACTCGAGTAGTTGACTATCATTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks