EMAIL THIS PAGE TO A FRIEND

ATG16L2

autophagy related 16-like 2 (S. cerevisiae)

94 Gene Product Result for
Synonyms: ATG16B WDR80
UniProtKB ID: Q8NAA4, A5PL30, B2RPK5, Q658V4, Q6PID3, Q8NBG0
Gene ID:
Mouse(73683) autophagy related 16-like 2 (S. cerevisiae)
Rat(308865) autophagy related 16-like 2 (S. cerevisiae)
sheep(101103839) autophagy related 16-like 2 (S. cerevisiae)
domestic guinea pig(100730878) autophagy related 16-like 2 (S. cerevisiae)
naked mole-rat(101723082) autophagy related 16-like 2 (S. cerevisiae)
Zebrafish(100034627) ATG16 autophagy related 16-like 2 (S. cerevisiae)
cow(511036) ATG16 autophagy related 16-like 2 (S. cerevisiae)
domestic cat(101083109) autophagy related 16-like 2 (S. cerevisiae)
dog(485205) autophagy related 16-like 2 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033388 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001111111 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001111111 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001111111 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021991 MISSION® esiRNA esiRNA human ATG16L2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033388 Rosetta Predictions human pricing
XM_218966 Rosetta Predictions rat pricing
XR_008439 Rosetta Predictions rat pricing
NM_001111111 Rosetta Predictions mouse pricing
XM_133655 Rosetta Predictions mouse pricing
XM_992607 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118258 predicted 971
2 SASI_Hs01_00118259 predicted 300
3 SASI_Hs01_00118260 predicted 1105
4 SASI_Hs01_00118261 predicted 1411
5 SASI_Hs02_00361243 predicted 1298
6 SASI_Hs01_00118263 predicted 253
7 SASI_Hs02_00361244 predicted 1397
8 SASI_Hs01_00118264 predicted 1698
9 SASI_Hs01_00118266 predicted 225
10 SASI_Hs01_00118267 predicted 1635
11 SASI_Hs01_00118262 predicted 1704
12 SASI_Hs01_00118265 predicted 1289
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218966 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00195149 predicted 2181
2 SASI_Rn01_00195150 predicted 1827
3 SASI_Rn01_00195151 predicted 2154
4 SASI_Rn01_00195152 predicted 2109
5 SASI_Rn01_00195153 predicted 2187
6 SASI_Rn01_00195154 predicted 2070
7 SASI_Rn01_00195155 predicted 1903
8 SASI_Rn01_00195156 predicted 1666
9 SASI_Rn01_00195157 predicted 2085
10 SASI_Rn01_00195158 predicted 2147
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008439 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167788 predicted 721
2 SASI_Rn02_00417045 predicted 1003
3 SASI_Rn01_00167790 predicted 349
4 SASI_Rn02_00417046 predicted 374
5 SASI_Rn01_00167791 predicted 586
6 SASI_Rn02_00417047 predicted 990
7 SASI_Rn01_00167792 predicted 375
8 SASI_Rn01_00167793 predicted 334
9 SASI_Rn01_00167796 predicted 642
10 SASI_Rn02_00417048 predicted 923
11 SASI_Rn01_00167789 predicted 503
12 SASI_Rn01_00167794 predicted 805
13 SASI_Rn01_00167795 predicted 561
14 SASI_Rn01_00167797 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111111 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306452 predicted 1781
2 SASI_Mm02_00306453 predicted 1637
3 SASI_Mm02_00306454 predicted 1315
4 SASI_Mm02_00306455 predicted 687
5 SASI_Mm02_00306456 predicted 1806
6 SASI_Mm02_00306457 predicted 1668
7 SASI_Mm02_00306458 predicted 562
8 SASI_Mm02_00306459 predicted 1934
9 SASI_Mm02_00306460 predicted 1848
10 SASI_Mm02_00306461 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255280 predicted 331
2 SASI_Mm01_00255281 predicted 1610
3 SASI_Mm01_00255282 predicted 1306
4 SASI_Mm01_00255283 predicted 380
5 SASI_Mm01_00255284 predicted 1600
6 SASI_Mm01_00255285 predicted 1017
7 SASI_Mm01_00255286 predicted 1236
8 SASI_Mm01_00255287 predicted 1175
9 SASI_Mm01_00255288 predicted 1464
10 SASI_Mm01_00255289 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210658 predicted 1280
2 SASI_Mm01_00210659 predicted 1276
3 SASI_Mm01_00210660 predicted 781
4 SASI_Mm01_00210661 predicted 1165
5 SASI_Mm01_00210662 predicted 655
6 SASI_Mm01_00210663 predicted 883
7 SASI_Mm01_00210664 predicted 878
8 SASI_Mm01_00210665 predicted 1188
9 SASI_Mm01_00210666 predicted 584
10 SASI_Mm01_00210667 predicted 810
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033388
ATG16L2 MISSION shRNA Bacterial Glycerol Stock
autophagy related 16-like 2 (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033388.1-1671s1c1
Sequence:CCGGGCTTCAAGTGTGGTTCTGACTCTCGAGAGTCAGAACCACACTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033388.1-156s1c1
Sequence:CCGGCCTATAACCATCTCTTAGAGACTCGAGTCTCTAAGAGATGGTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033388.1-1410s1c1
Sequence:CCGGCCAGGACCATCAATGTCCTTTCTCGAGAAAGGACATTGATGGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033388.1-1480s1c1
Sequence:CCGGCAATGACCAGAAGATCCGGTTCTCGAGAACCGGATCTTCTGGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033388.1-1420s1c1
Sequence:CCGGCAATGTCCTTTCCTACTGTAACTCGAGTTACAGTAGGAAAGGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033388
ATG16L2 MISSION shRNA shRNA Plasmid DNA
autophagy related 16-like 2 (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033388.1-1671s1c1
Sequence:CCGGGCTTCAAGTGTGGTTCTGACTCTCGAGAGTCAGAACCACACTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033388.1-156s1c1
Sequence:CCGGCCTATAACCATCTCTTAGAGACTCGAGTCTCTAAGAGATGGTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033388.1-1410s1c1
Sequence:CCGGCCAGGACCATCAATGTCCTTTCTCGAGAAAGGACATTGATGGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033388.1-1480s1c1
Sequence:CCGGCAATGACCAGAAGATCCGGTTCTCGAGAACCGGATCTTCTGGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033388.1-1420s1c1
Sequence:CCGGCAATGTCCTTTCCTACTGTAACTCGAGTTACAGTAGGAAAGGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033388
ATG16L2 MISSION shRNA Lentiviral Transduction Particles
autophagy related 16-like 2 (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033388.1-1671s1c1
Sequence:CCGGGCTTCAAGTGTGGTTCTGACTCTCGAGAGTCAGAACCACACTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033388.1-156s1c1
Sequence:CCGGCCTATAACCATCTCTTAGAGACTCGAGTCTCTAAGAGATGGTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033388.1-1410s1c1
Sequence:CCGGCCAGGACCATCAATGTCCTTTCTCGAGAAAGGACATTGATGGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033388.1-1480s1c1
Sequence:CCGGCAATGACCAGAAGATCCGGTTCTCGAGAACCGGATCTTCTGGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033388.1-1420s1c1
Sequence:CCGGCAATGTCCTTTCCTACTGTAACTCGAGTTACAGTAGGAAAGGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001111111
VALIDATED
ATG16L2 MISSION shRNA Bacterial Glycerol Stock
autophagy related 16-like 2 (S. cerevisiae)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111111.1-1342s21c1
Sequence:CCGGCAAAGTGACTGCTGCCAAATTCTCGAGAATTTGGCAGCAGTCACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111111.1-172s21c1
Sequence:CCGGGGAGCTAGTGCCGGCTTATAACTCGAGTTATAAGCCGGCACTAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111111.1-1640s21c1
Sequence:CCGGGACAACACACTCAAGGTTATCCTCGAGGATAACCTTGAGTGTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111111.1-683s21c1
Sequence:CCGGGCTGAGCGCAATCTACGTAATCTCGAGATTACGTAGATTGCGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001111111
VALIDATED
ATG16L2 MISSION shRNA shRNA Plasmid DNA
autophagy related 16-like 2 (S. cerevisiae)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111111.1-1342s21c1
Sequence:CCGGCAAAGTGACTGCTGCCAAATTCTCGAGAATTTGGCAGCAGTCACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111111.1-172s21c1
Sequence:CCGGGGAGCTAGTGCCGGCTTATAACTCGAGTTATAAGCCGGCACTAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111111.1-1640s21c1
Sequence:CCGGGACAACACACTCAAGGTTATCCTCGAGGATAACCTTGAGTGTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111111.1-683s21c1
Sequence:CCGGGCTGAGCGCAATCTACGTAATCTCGAGATTACGTAGATTGCGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001111111
VALIDATED
ATG16L2 MISSION shRNA Lentiviral Transduction Particles
autophagy related 16-like 2 (S. cerevisiae)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111111.1-1342s21c1
Sequence:CCGGCAAAGTGACTGCTGCCAAATTCTCGAGAATTTGGCAGCAGTCACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111111.1-172s21c1
Sequence:CCGGGGAGCTAGTGCCGGCTTATAACTCGAGTTATAAGCCGGCACTAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111111.1-1640s21c1
Sequence:CCGGGACAACACACTCAAGGTTATCCTCGAGGATAACCTTGAGTGTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001111111.1-683s21c1
Sequence:CCGGGCTGAGCGCAATCTACGTAATCTCGAGATTACGTAGATTGCGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks