EMAIL THIS PAGE TO A FRIEND

ATG2A

autophagy related 2A

73 Gene Product Result for
Gene ID:
Mouse(329015) autophagy related 2A
Rat(689688) autophagy related 2A
cow(529808) ATG2 autophagy related 2 homolog A (S. cerevisiae)
dog(483756) autophagy related 2A
domestic cat(101080739) autophagy related 2A
naked mole-rat(101706866) autophagy related 2A
domestic guinea pig(100723532) autophagy related 2A
sheep(101119171) autophagy related 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015104 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015104 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015104 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_194348 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194348 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194348 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015104 Rosetta Predictions human pricing
NM_001109545 Rosetta Predictions rat pricing
NM_194348 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346994 predicted 2946
2 SASI_Hs01_00143908 predicted 5838
3 SASI_Hs01_00143909 predicted 1039
4 SASI_Hs01_00143910 predicted 2387
5 SASI_Hs01_00143911 predicted 219
6 SASI_Hs01_00143912 predicted 200
7 SASI_Hs01_00143913 predicted 2547
8 SASI_Hs01_00143914 predicted 1649
9 SASI_Hs01_00143915 predicted 4718
10 SASI_Hs01_00143916 predicted 5466
11 SASI_Hs01_00143907 predicted 4086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109545 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249449 predicted 5090
2 SASI_Rn02_00249450 predicted 2307
3 SASI_Rn02_00249451 predicted 2723
4 SASI_Rn02_00249452 predicted 625
5 SASI_Rn02_00249453 predicted 4630
6 SASI_Rn02_00249454 predicted 5547
7 SASI_Rn02_00249455 predicted 3229
8 SASI_Rn02_00249456 predicted 1577
9 SASI_Rn02_00249457 predicted 5037
10 SASI_Rn02_00249458 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194348 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031447 predicted 1108
2 SASI_Mm01_00031448 predicted 2723
3 SASI_Mm01_00031449 predicted 2307
4 SASI_Mm01_00031450 predicted 3227
5 SASI_Mm01_00031451 predicted 5080
6 SASI_Mm01_00031452 predicted 621
7 SASI_Mm01_00031453 predicted 957
8 SASI_Mm01_00031454 predicted 1566
9 SASI_Mm01_00031455 predicted 5642
10 SASI_Mm01_00031456 predicted 4376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015104
VALIDATED
ATG2A MISSION shRNA Bacterial Glycerol Stock
autophagy related 2A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015104.2-2448s21c1
Sequence:CCGGCCTCTAAGAGGACCATGTATGCTCGAGCATACATGGTCCTCTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015104.2-3309s21c1
Sequence:CCGGTGACACTGCGGTTGCACAAAGCTCGAGCTTTGTGCAACCGCAGTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015104.2-4280s21c1
Sequence:CCGGATCGTTGTGAGGGACGGTTACCTCGAGGTAACCGTCCCTCACAACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015104.1-5642s1c1
Sequence:CCGGCTTGGATACAGCTCAGACCATCTCGAGATGGTCTGAGCTGTATCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015104.1-1130s1c1
Sequence:CCGGCCTGGATAACACTGACCTCTTCTCGAGAAGAGGTCAGTGTTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015104.1-1120s1c1
Sequence:CCGGCCCTTCTCAACCTGGATAACACTCGAGTGTTATCCAGGTTGAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015104.1-3609s1c1
Sequence:CCGGGATGTTGACCTCTTGGAACTTCTCGAGAAGTTCCAAGAGGTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015104
VALIDATED
ATG2A MISSION shRNA shRNA Plasmid DNA
autophagy related 2A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015104.2-2448s21c1
Sequence:CCGGCCTCTAAGAGGACCATGTATGCTCGAGCATACATGGTCCTCTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015104.2-3309s21c1
Sequence:CCGGTGACACTGCGGTTGCACAAAGCTCGAGCTTTGTGCAACCGCAGTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015104.2-4280s21c1
Sequence:CCGGATCGTTGTGAGGGACGGTTACCTCGAGGTAACCGTCCCTCACAACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015104.1-5642s1c1
Sequence:CCGGCTTGGATACAGCTCAGACCATCTCGAGATGGTCTGAGCTGTATCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015104.1-1130s1c1
Sequence:CCGGCCTGGATAACACTGACCTCTTCTCGAGAAGAGGTCAGTGTTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015104.1-1120s1c1
Sequence:CCGGCCCTTCTCAACCTGGATAACACTCGAGTGTTATCCAGGTTGAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015104.1-3609s1c1
Sequence:CCGGGATGTTGACCTCTTGGAACTTCTCGAGAAGTTCCAAGAGGTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015104
VALIDATED
ATG2A MISSION shRNA Lentiviral Transduction Particles
autophagy related 2A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015104.2-2448s21c1
Sequence:CCGGCCTCTAAGAGGACCATGTATGCTCGAGCATACATGGTCCTCTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015104.2-3309s21c1
Sequence:CCGGTGACACTGCGGTTGCACAAAGCTCGAGCTTTGTGCAACCGCAGTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015104.2-4280s21c1
Sequence:CCGGATCGTTGTGAGGGACGGTTACCTCGAGGTAACCGTCCCTCACAACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015104.1-5642s1c1
Sequence:CCGGCTTGGATACAGCTCAGACCATCTCGAGATGGTCTGAGCTGTATCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015104.1-1130s1c1
Sequence:CCGGCCTGGATAACACTGACCTCTTCTCGAGAAGAGGTCAGTGTTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015104.1-1120s1c1
Sequence:CCGGCCCTTCTCAACCTGGATAACACTCGAGTGTTATCCAGGTTGAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015104.1-3609s1c1
Sequence:CCGGGATGTTGACCTCTTGGAACTTCTCGAGAAGTTCCAAGAGGTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194348
ATG2A MISSION shRNA Bacterial Glycerol Stock
autophagy related 2A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000194493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194348.2-6054s1c1
Sequence:CCGGGAAAGGACATTGCTTCTCCCTCTCGAGAGGGAGAAGCAATGTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194348.2-2556s1c1
Sequence:CCGGCGAAAGTATCTACAACAGGATCTCGAGATCCTGTTGTAGATACTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194348.2-6096s1c1
Sequence:CCGGGCCTTGTTCCAGAATGAGGATCTCGAGATCCTCATTCTGGAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194348.2-6105s1c1
Sequence:CCGGCAGAATGAGGATGGAGGCTTTCTCGAGAAAGCCTCCATCCTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194348
ATG2A MISSION shRNA shRNA Plasmid DNA
autophagy related 2A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000194493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194348.2-6054s1c1
Sequence:CCGGGAAAGGACATTGCTTCTCCCTCTCGAGAGGGAGAAGCAATGTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194348.2-2556s1c1
Sequence:CCGGCGAAAGTATCTACAACAGGATCTCGAGATCCTGTTGTAGATACTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194348.2-6096s1c1
Sequence:CCGGGCCTTGTTCCAGAATGAGGATCTCGAGATCCTCATTCTGGAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194348.2-6105s1c1
Sequence:CCGGCAGAATGAGGATGGAGGCTTTCTCGAGAAAGCCTCCATCCTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194348
ATG2A MISSION shRNA Lentiviral Transduction Particles
autophagy related 2A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000194493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194348.2-6054s1c1
Sequence:CCGGGAAAGGACATTGCTTCTCCCTCTCGAGAGGGAGAAGCAATGTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194348.2-2556s1c1
Sequence:CCGGCGAAAGTATCTACAACAGGATCTCGAGATCCTGTTGTAGATACTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194348.2-6096s1c1
Sequence:CCGGGCCTTGTTCCAGAATGAGGATCTCGAGATCCTCATTCTGGAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194348.2-6105s1c1
Sequence:CCGGCAGAATGAGGATGGAGGCTTTCTCGAGAAAGCCTCCATCCTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks