EMAIL THIS PAGE TO A FRIEND

ATG2B

autophagy related 2B

Synonyms: C14orf103
UniProtKB ID: Q96BY7, Q6ZRE7, Q96DQ3, Q9NW80
Gene ID:
Mouse(76559) autophagy related 2B
sheep(101121043) autophagy related 2B
Domestic Rabbit(100339862) autophagy related 2B
domestic guinea pig(100724806) autophagy related 2B
naked mole-rat(101716535) autophagy related 2B
Zebrafish(100329593) ATG2 autophagy related 2 homolog B (S. cerevisiae)
cow(519961) autophagy related 2B
Horse(100054652) autophagy related 2B
chicken(423441) autophagy related 2B
domestic cat(101090948) autophagy related 2B
dog(480428) autophagy related 2B
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029654 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029654 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029654 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018036 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018036 Rosetta Predictions human pricing
NM_029654 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351149 predicted 2133
2 SASI_Hs01_00213879 predicted 5926
3 SASI_Hs02_00351150 predicted 2885
4 SASI_Hs01_00213882 predicted 5817
5 SASI_Hs02_00351151 predicted 2004
6 SASI_Hs02_00351152 predicted 2420
7 SASI_Hs01_00213884 predicted 4271
8 SASI_Hs01_00213886 predicted 4470
9 SASI_Hs01_00213887 predicted 6033
10 SASI_Hs02_00351153 predicted 4367
11 SASI_Hs01_00213878 predicted 370
12 SASI_Hs01_00213880 predicted 697
13 SASI_Hs01_00213881 predicted 1367
14 SASI_Hs01_00213883 predicted 1129
15 SASI_Hs01_00213885 predicted 1856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335666 predicted 2377
2 SASI_Mm01_00101616 predicted 5991
3 SASI_Mm02_00335667 predicted 3253
4 SASI_Mm02_00335668 predicted 743
5 SASI_Mm02_00335669 predicted 1322
6 SASI_Mm02_00335670 predicted 2080
7 SASI_Mm02_00335671 predicted 2673
8 SASI_Mm02_00335672 predicted 870
9 SASI_Mm02_00335673 predicted 4063
10 SASI_Mm01_00101623 predicted 5402
11 SASI_Mm01_00101617 predicted 1034
12 SASI_Mm01_00101618 predicted 1328
13 SASI_Mm01_00101619 predicted 2230
14 SASI_Mm01_00101620 predicted 596
15 SASI_Mm01_00101621 predicted 1804
16 SASI_Mm01_00101622 predicted 2822
17 SASI_Mm01_00101624 predicted 1353
18 SASI_Mm01_00101625 predicted 615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029654
ATG2B MISSION shRNA Bacterial Glycerol Stock
autophagy related 2B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029654.3-2654s1c1
Sequence:CCGGCGAGGCGACATCAAATGTGTTCTCGAGAACACATTTGATGTCGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029654.3-1149s1c1
Sequence:CCGGGCCGTCCGATATGTTGTTAAACTCGAGTTTAACAACATATCGGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029654.3-2191s1c1
Sequence:CCGGCTATGCATTCACTAGTTCAATCTCGAGATTGAACTAGTGAATGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029654.4-6842s21c1
Sequence:CCGGGGTGTCAGTCACTAGAGATTTCTCGAGAAATCTCTAGTGACTGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029654.4-2546s1c1
Sequence:CCGGCGTCCTATAACAAGCATATTACTCGAGTAATATGCTTGTTATAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216918    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029654.4-8014s1c1
Sequence:CCGGCATTTGCATTCGCTCGATTTCCTCGAGGAAATCGAGCGAATGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029654.4-2452s21c1
Sequence:CCGGTGCGAGCTGGATATCAGTATTCTCGAGAATACTGATATCCAGCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029654.4-1513s21c1
Sequence:CCGGATGGAATTAAACCGGTATTATCTCGAGATAATACCGGTTTAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029654.4-4356s21c1
Sequence:CCGGGCTGACCATAACCGCAGTAAACTCGAGTTTACTGCGGTTATGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029654.4-2124s21c1
Sequence:CCGGACACGATCACCTTAGGTTTATCTCGAGATAAACCTAAGGTGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029654
ATG2B MISSION shRNA shRNA Plasmid DNA
autophagy related 2B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029654.3-2654s1c1
Sequence:CCGGCGAGGCGACATCAAATGTGTTCTCGAGAACACATTTGATGTCGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029654.3-1149s1c1
Sequence:CCGGGCCGTCCGATATGTTGTTAAACTCGAGTTTAACAACATATCGGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029654.3-2191s1c1
Sequence:CCGGCTATGCATTCACTAGTTCAATCTCGAGATTGAACTAGTGAATGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029654.4-6842s21c1
Sequence:CCGGGGTGTCAGTCACTAGAGATTTCTCGAGAAATCTCTAGTGACTGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029654.4-2546s1c1
Sequence:CCGGCGTCCTATAACAAGCATATTACTCGAGTAATATGCTTGTTATAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216918    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029654.4-8014s1c1
Sequence:CCGGCATTTGCATTCGCTCGATTTCCTCGAGGAAATCGAGCGAATGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029654.4-2452s21c1
Sequence:CCGGTGCGAGCTGGATATCAGTATTCTCGAGAATACTGATATCCAGCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029654.4-1513s21c1
Sequence:CCGGATGGAATTAAACCGGTATTATCTCGAGATAATACCGGTTTAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029654.4-4356s21c1
Sequence:CCGGGCTGACCATAACCGCAGTAAACTCGAGTTTACTGCGGTTATGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029654.4-2124s21c1
Sequence:CCGGACACGATCACCTTAGGTTTATCTCGAGATAAACCTAAGGTGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029654
ATG2B MISSION shRNA Lentiviral Transduction Particles
autophagy related 2B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029654.3-2654s1c1
Sequence:CCGGCGAGGCGACATCAAATGTGTTCTCGAGAACACATTTGATGTCGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029654.3-1149s1c1
Sequence:CCGGGCCGTCCGATATGTTGTTAAACTCGAGTTTAACAACATATCGGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029654.3-2191s1c1
Sequence:CCGGCTATGCATTCACTAGTTCAATCTCGAGATTGAACTAGTGAATGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029654.4-6842s21c1
Sequence:CCGGGGTGTCAGTCACTAGAGATTTCTCGAGAAATCTCTAGTGACTGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029654.4-2546s1c1
Sequence:CCGGCGTCCTATAACAAGCATATTACTCGAGTAATATGCTTGTTATAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216918    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029654.4-8014s1c1
Sequence:CCGGCATTTGCATTCGCTCGATTTCCTCGAGGAAATCGAGCGAATGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029654.4-2452s21c1
Sequence:CCGGTGCGAGCTGGATATCAGTATTCTCGAGAATACTGATATCCAGCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029654.4-1513s21c1
Sequence:CCGGATGGAATTAAACCGGTATTATCTCGAGATAATACCGGTTTAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029654.4-4356s21c1
Sequence:CCGGGCTGACCATAACCGCAGTAAACTCGAGTTTACTGCGGTTATGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029654.4-2124s21c1
Sequence:CCGGACACGATCACCTTAGGTTTATCTCGAGATAAACCTAAGGTGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018036
VALIDATED
ATG2B MISSION shRNA Bacterial Glycerol Stock
autophagy related 2B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018036.4-1389s1c1
Sequence:CCGGCTGCCCGTTAATAAGACCGATCTCGAGATCGGTCTTATTAACGGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018036.4-580s1c1
Sequence:CCGGGATCTCTTCTTACCGTGGAAACTCGAGTTTCCACGGTAAGAAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018036.4-1573s1c1
Sequence:CCGGCCACGAGACATGGACGTAATACTCGAGTATTACGTCCATGTCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_018036.4-1811s1c1
Sequence:CCGGCAGTAAAGAAATGCCTCGAAACTCGAGTTTCGAGGCATTTCTTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018036.4-832s1c1
Sequence:CCGGGCGATGTTGTCCATATCAGAACTCGAGTTCTGATATGGACAACATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018036.4-3617s1c1
Sequence:CCGGGCAGACATGTTCTGTTGTGTTCTCGAGAACACAACAGAACATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370361    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018036.5-6768s21c1
Sequence:CCGGTCTGACATTTATAGTTGATACCTCGAGGTATCAACTATAAATGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018036.5-1656s21c1
Sequence:CCGGATGGACCTTGAGTTATCATTACTCGAGTAATGATAACTCAAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018036.5-1947s21c1
Sequence:CCGGGAAACGTCACAGAACCTTAATCTCGAGATTAAGGTTCTGTGACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018036.5-4247s21c1
Sequence:CCGGATGCAATACTGTCACTATAAACTCGAGTTTATAGTGACAGTATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018036.5-1467s21c1
Sequence:CCGGATGGAATTAAACCGGTATTATCTCGAGATAATACCGGTTTAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018036.5-3788s21c1
Sequence:CCGGCTGGTTGGAACCTACTATTTACTCGAGTAAATAGTAGGTTCCAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018036
VALIDATED
ATG2B MISSION shRNA shRNA Plasmid DNA
autophagy related 2B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018036.4-1389s1c1
Sequence:CCGGCTGCCCGTTAATAAGACCGATCTCGAGATCGGTCTTATTAACGGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018036.4-580s1c1
Sequence:CCGGGATCTCTTCTTACCGTGGAAACTCGAGTTTCCACGGTAAGAAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018036.4-1573s1c1
Sequence:CCGGCCACGAGACATGGACGTAATACTCGAGTATTACGTCCATGTCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_018036.4-1811s1c1
Sequence:CCGGCAGTAAAGAAATGCCTCGAAACTCGAGTTTCGAGGCATTTCTTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018036.4-832s1c1
Sequence:CCGGGCGATGTTGTCCATATCAGAACTCGAGTTCTGATATGGACAACATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018036.4-3617s1c1
Sequence:CCGGGCAGACATGTTCTGTTGTGTTCTCGAGAACACAACAGAACATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370361    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018036.5-6768s21c1
Sequence:CCGGTCTGACATTTATAGTTGATACCTCGAGGTATCAACTATAAATGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018036.5-1656s21c1
Sequence:CCGGATGGACCTTGAGTTATCATTACTCGAGTAATGATAACTCAAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018036.5-1947s21c1
Sequence:CCGGGAAACGTCACAGAACCTTAATCTCGAGATTAAGGTTCTGTGACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018036.5-4247s21c1
Sequence:CCGGATGCAATACTGTCACTATAAACTCGAGTTTATAGTGACAGTATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018036.5-1467s21c1
Sequence:CCGGATGGAATTAAACCGGTATTATCTCGAGATAATACCGGTTTAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018036.5-3788s21c1
Sequence:CCGGCTGGTTGGAACCTACTATTTACTCGAGTAAATAGTAGGTTCCAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018036
VALIDATED
ATG2B MISSION shRNA Lentiviral Transduction Particles
autophagy related 2B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018036.4-1389s1c1
Sequence:CCGGCTGCCCGTTAATAAGACCGATCTCGAGATCGGTCTTATTAACGGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018036.4-580s1c1
Sequence:CCGGGATCTCTTCTTACCGTGGAAACTCGAGTTTCCACGGTAAGAAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018036.4-1573s1c1
Sequence:CCGGCCACGAGACATGGACGTAATACTCGAGTATTACGTCCATGTCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_018036.4-1811s1c1
Sequence:CCGGCAGTAAAGAAATGCCTCGAAACTCGAGTTTCGAGGCATTTCTTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018036.4-832s1c1
Sequence:CCGGGCGATGTTGTCCATATCAGAACTCGAGTTCTGATATGGACAACATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018036.4-3617s1c1
Sequence:CCGGGCAGACATGTTCTGTTGTGTTCTCGAGAACACAACAGAACATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370361    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018036.5-6768s21c1
Sequence:CCGGTCTGACATTTATAGTTGATACCTCGAGGTATCAACTATAAATGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018036.5-1656s21c1
Sequence:CCGGATGGACCTTGAGTTATCATTACTCGAGTAATGATAACTCAAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018036.5-1947s21c1
Sequence:CCGGGAAACGTCACAGAACCTTAATCTCGAGATTAAGGTTCTGTGACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018036.5-4247s21c1
Sequence:CCGGATGCAATACTGTCACTATAAACTCGAGTTTATAGTGACAGTATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018036.5-1467s21c1
Sequence:CCGGATGGAATTAAACCGGTATTATCTCGAGATAATACCGGTTTAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018036.5-3788s21c1
Sequence:CCGGCTGGTTGGAACCTACTATTTACTCGAGTAAATAGTAGGTTCCAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks