EMAIL THIS PAGE TO A FRIEND

ATG3

autophagy related 3

87 Gene Product Result for
Synonyms: APG3 APG3-LIKE APG3L PC3-96
UniProtKB ID: Q9NT62, Q6PKC5, Q9H6L9
Gene ID:
Human(64422) Summary: This gene encodes a ubiquitin-like-conjugating enzyme and is a component of ubiquitination-like systems involved in autophagy, the process of degradation, turnover and recycling of cytoplasmic constituents in eukaryotic cells. This protein is known to play a role in regulation of autophagy during cell death. A pseudogene of this gene is located on chromosome 20. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Mouse(67841) autophagy related 3
Rat(171415) autophagy related 3
Thale Cress(836271) autophagy-related protein 3
cow(508571) ATG3 autophagy related 3 homolog (S. cerevisiae)
domestic cat(101088607) autophagy related 3
dog(478564) autophagy related 3
chicken(418369) autophagy related 3
naked mole-rat(101697524) autophagy related 3
domestic guinea pig(100732478) autophagy related 3
sheep(101121560) autophagy related 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022488 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022488 Rosetta Predictions human pricing
NM_134394 Rosetta Predictions rat pricing
NM_026402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022874 predicted 927
2 SASI_Hs01_00022875 predicted 996
3 SASI_Hs01_00022876 predicted 945
4 SASI_Hs01_00022877 predicted 308
5 SASI_Hs01_00022878 predicted 256
6 SASI_Hs01_00022879 predicted 306
7 SASI_Hs01_00022880 predicted 229
8 SASI_Hs01_00022881 predicted 237
9 SASI_Hs02_00355784 predicted 288
10 SASI_Hs02_00355785 predicted 244
11 SASI_Hs01_00022882 predicted 903
12 SASI_Hs01_00022883 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267962 predicted 477
2 SASI_Rn01_00065280 predicted 883
3 SASI_Rn01_00065281 predicted 648
4 SASI_Rn01_00065282 predicted 428
5 SASI_Rn01_00065283 predicted 877
6 SASI_Rn01_00065286 predicted 517
7 SASI_Rn01_00065287 predicted 406
8 SASI_Rn01_00065288 predicted 1048
9 SASI_Rn01_00065289 predicted 619
10 SASI_Rn02_00267963 predicted 608
11 SASI_Rn01_00065284 predicted 480
12 SASI_Rn01_00065285 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037932 predicted 461
2 SASI_Mm02_00330185 predicted 517
3 SASI_Mm02_00330186 predicted 455
4 SASI_Mm02_00330187 predicted 757
5 SASI_Mm01_00037934 predicted 946
6 SASI_Mm01_00037936 predicted 630
7 SASI_Mm01_00037938 predicted 418
8 SASI_Mm01_00037939 predicted 533
9 SASI_Mm02_00330188 predicted 912
10 SASI_Mm02_00330189 predicted 590
11 SASI_Mm01_00037933 predicted 1280
12 SASI_Mm01_00037935 predicted 1241
13 SASI_Mm01_00037937 predicted 1205
14 SASI_Mm01_00037940 predicted 1315
15 SASI_Mm01_00037941 predicted 1229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022488
VALIDATED
ATG3 MISSION shRNA Bacterial Glycerol Stock
autophagy related 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_022488.3-308s21c1
Sequence:CCGGCCTACCAACAGGCAAACAATTCTCGAGAATTGTTTGCCTGTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_022488.3-1005s21c1
Sequence:CCGGGCTGTCATTCCAACAATAGAACTCGAGTTCTATTGTTGGAATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_022488.3-700s21c1
Sequence:CCGGCCAGAACTTATGACCTTTACACTCGAGTGTAAAGGTCATAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_022488.3-743s21c1
Sequence:CCGGGACTCCACGATTATGGTTGTTCTCGAGAACAACCATAATCGTGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022488.3-743s1c1
Sequence:CCGGGACTCCACGATTATGGTTGTTCTCGAGAACAACCATAATCGTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022488.3-1116s1c1
Sequence:CCGGGATGTGACCATTGACCATATTCTCGAGAATATGGTCAATGGTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022488.3-308s1c1
Sequence:CCGGCCTACCAACAGGCAAACAATTCTCGAGAATTGTTTGCCTGTTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022488.3-1005s1c1
Sequence:CCGGGCTGTCATTCCAACAATAGAACTCGAGTTCTATTGTTGGAATGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_022488.3-700s1c1
Sequence:CCGGCCAGAACTTATGACCTTTACACTCGAGTGTAAAGGTCATAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022488
VALIDATED
ATG3 MISSION shRNA shRNA Plasmid DNA
autophagy related 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_022488.3-308s21c1
Sequence:CCGGCCTACCAACAGGCAAACAATTCTCGAGAATTGTTTGCCTGTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_022488.3-1005s21c1
Sequence:CCGGGCTGTCATTCCAACAATAGAACTCGAGTTCTATTGTTGGAATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_022488.3-700s21c1
Sequence:CCGGCCAGAACTTATGACCTTTACACTCGAGTGTAAAGGTCATAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_022488.3-743s21c1
Sequence:CCGGGACTCCACGATTATGGTTGTTCTCGAGAACAACCATAATCGTGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022488.3-743s1c1
Sequence:CCGGGACTCCACGATTATGGTTGTTCTCGAGAACAACCATAATCGTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022488.3-1116s1c1
Sequence:CCGGGATGTGACCATTGACCATATTCTCGAGAATATGGTCAATGGTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022488.3-308s1c1
Sequence:CCGGCCTACCAACAGGCAAACAATTCTCGAGAATTGTTTGCCTGTTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022488.3-1005s1c1
Sequence:CCGGGCTGTCATTCCAACAATAGAACTCGAGTTCTATTGTTGGAATGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_022488.3-700s1c1
Sequence:CCGGCCAGAACTTATGACCTTTACACTCGAGTGTAAAGGTCATAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022488
VALIDATED
ATG3 MISSION shRNA Lentiviral Transduction Particles
autophagy related 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_022488.3-308s21c1
Sequence:CCGGCCTACCAACAGGCAAACAATTCTCGAGAATTGTTTGCCTGTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_022488.3-1005s21c1
Sequence:CCGGGCTGTCATTCCAACAATAGAACTCGAGTTCTATTGTTGGAATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_022488.3-700s21c1
Sequence:CCGGCCAGAACTTATGACCTTTACACTCGAGTGTAAAGGTCATAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_022488.3-743s21c1
Sequence:CCGGGACTCCACGATTATGGTTGTTCTCGAGAACAACCATAATCGTGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022488.3-743s1c1
Sequence:CCGGGACTCCACGATTATGGTTGTTCTCGAGAACAACCATAATCGTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022488.3-1116s1c1
Sequence:CCGGGATGTGACCATTGACCATATTCTCGAGAATATGGTCAATGGTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022488.3-308s1c1
Sequence:CCGGCCTACCAACAGGCAAACAATTCTCGAGAATTGTTTGCCTGTTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022488.3-1005s1c1
Sequence:CCGGGCTGTCATTCCAACAATAGAACTCGAGTTCTATTGTTGGAATGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_022488.3-700s1c1
Sequence:CCGGCCAGAACTTATGACCTTTACACTCGAGTGTAAAGGTCATAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026402
VALIDATED
ATG3 MISSION shRNA Bacterial Glycerol Stock
autophagy related 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026402.3-509s21c1
Sequence:CCGGCCATGCTACAAGCGGTGTAAACTCGAGTTTACACCGCTTGTAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026402.3-600s1c1
Sequence:CCGGCATATCACAACACAGGTATTACTCGAGTAATACCTGTGTTGTGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026402.3-1163s1c1
Sequence:CCGGCAAGCTGTCATTCCAACAATACTCGAGTATTGTTGGAATGACAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026402.3-352s21c1
Sequence:CCGGATTTAAGGAAACGGGTGTAATCTCGAGATTACACCCGTTTCCTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026402.3-877s21c1
Sequence:CCGGGTACATCACTTACGACAAATACTCGAGTATTTGTCGTAAGTGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247441    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026402.3-1279s21c1
Sequence:CCGGTGTGACCATTGACCATATTTACTCGAGTAAATATGGTCAATGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026402.3-600s21c1
Sequence:CCGGCATATCACAACACAGGTATTACTCGAGTAATACCTGTGTTGTGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026402.1-521s1c1
Sequence:CCGGGCGGTGTAAACAGATGGAGTACTCGAGTACTCCATCTGTTTACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026402.1-639s1c1
Sequence:CCGGGTTAAGGAGATTACACTGGAACTCGAGTTCCAGTGTAATCTCCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026402
VALIDATED
ATG3 MISSION shRNA shRNA Plasmid DNA
autophagy related 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026402.3-509s21c1
Sequence:CCGGCCATGCTACAAGCGGTGTAAACTCGAGTTTACACCGCTTGTAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026402.3-600s1c1
Sequence:CCGGCATATCACAACACAGGTATTACTCGAGTAATACCTGTGTTGTGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026402.3-1163s1c1
Sequence:CCGGCAAGCTGTCATTCCAACAATACTCGAGTATTGTTGGAATGACAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026402.3-352s21c1
Sequence:CCGGATTTAAGGAAACGGGTGTAATCTCGAGATTACACCCGTTTCCTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026402.3-877s21c1
Sequence:CCGGGTACATCACTTACGACAAATACTCGAGTATTTGTCGTAAGTGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247441    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026402.3-1279s21c1
Sequence:CCGGTGTGACCATTGACCATATTTACTCGAGTAAATATGGTCAATGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026402.3-600s21c1
Sequence:CCGGCATATCACAACACAGGTATTACTCGAGTAATACCTGTGTTGTGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026402.1-521s1c1
Sequence:CCGGGCGGTGTAAACAGATGGAGTACTCGAGTACTCCATCTGTTTACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026402.1-639s1c1
Sequence:CCGGGTTAAGGAGATTACACTGGAACTCGAGTTCCAGTGTAATCTCCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026402
VALIDATED
ATG3 MISSION shRNA Lentiviral Transduction Particles
autophagy related 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026402.3-509s21c1
Sequence:CCGGCCATGCTACAAGCGGTGTAAACTCGAGTTTACACCGCTTGTAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026402.3-600s1c1
Sequence:CCGGCATATCACAACACAGGTATTACTCGAGTAATACCTGTGTTGTGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026402.3-1163s1c1
Sequence:CCGGCAAGCTGTCATTCCAACAATACTCGAGTATTGTTGGAATGACAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026402.3-352s21c1
Sequence:CCGGATTTAAGGAAACGGGTGTAATCTCGAGATTACACCCGTTTCCTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026402.3-877s21c1
Sequence:CCGGGTACATCACTTACGACAAATACTCGAGTATTTGTCGTAAGTGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247441    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026402.3-1279s21c1
Sequence:CCGGTGTGACCATTGACCATATTTACTCGAGTAAATATGGTCAATGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026402.3-600s21c1
Sequence:CCGGCATATCACAACACAGGTATTACTCGAGTAATACCTGTGTTGTGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026402.1-521s1c1
Sequence:CCGGGCGGTGTAAACAGATGGAGTACTCGAGTACTCCATCTGTTTACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026402.1-639s1c1
Sequence:CCGGGTTAAGGAGATTACACTGGAACTCGAGTTCCAGTGTAATCTCCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks