EMAIL THIS PAGE TO A FRIEND

ATG4A

autophagy related 4A, cysteine peptidase

132 Gene Product Result for
Synonyms: APG4A AUTL2
Gene ID:
Human(115201) Summary: Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. Transcript variants that encode distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(666468) autophagy related 4A, cysteine peptidase
Rat(100910507) autophagy related 4A, cysteine peptidase
Zebrafish(554140) ATG4 autophagy related 4 homolog A (S. cerevisiae)
dog(481015) autophagy related 4A, cysteine peptidase
domestic cat(101088311) autophagy related 4A, cysteine peptidase
cow(408003) ATG4 autophagy related 4 homolog A (S. cerevisiae)
Horse(100060165) autophagy related 4A, cysteine peptidase
chicken(772074) ATG4 autophagy related 4 homolog A (S. cerevisiae)
sheep(101113390) autophagy related 4A, cysteine peptidase
Domestic Rabbit(100338183) autophagy related 4A, cysteine peptidase
domestic guinea pig(100723719) autophagy related 4A, cysteine peptidase
naked mole-rat(101720949) autophagy related 4A, cysteine peptidase
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174875 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174875 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174875 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052936 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052936 Rosetta Predictions human pricing
NM_178270 Rosetta Predictions human pricing
NM_178271 Rosetta Predictions human pricing
NM_174875 Rosetta Predictions mouse pricing
XM_984043 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150665 predicted 508
2 SASI_Hs01_00150666 predicted 487
3 SASI_Hs02_00361719 predicted 365
4 SASI_Hs01_00150668 predicted 465
5 SASI_Hs02_00361720 predicted 220
6 SASI_Hs01_00150669 predicted 1242
7 SASI_Hs01_00150670 predicted 1250
8 SASI_Hs01_00150671 predicted 488
9 SASI_Hs02_00361721 predicted 201
10 SASI_Hs01_00150674 predicted 1159
11 SASI_Hs01_00150667 predicted 444
12 SASI_Hs01_00150672 predicted 461
13 SASI_Hs01_00150673 predicted 1759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123139 predicted 512
2 SASI_Hs01_00123140 predicted 496
3 SASI_Hs02_00369623 predicted 367
4 SASI_Hs01_00123142 predicted 467
5 SASI_Hs02_00369624 predicted 217
6 SASI_Hs01_00123143 predicted 1056
7 SASI_Hs01_00123144 predicted 1067
8 SASI_Hs01_00123145 predicted 491
9 SASI_Hs02_00369625 predicted 198
10 SASI_Hs01_00123148 predicted 968
11 SASI_Hs01_00123141 predicted 452
12 SASI_Hs01_00123146 predicted 463
13 SASI_Hs01_00123147 predicted 1571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179480 predicted 813
2 SASI_Hs01_00179481 predicted 801
3 SASI_Hs01_00179482 predicted 754
4 SASI_Hs01_00179483 predicted 766
5 SASI_Hs01_00179484 predicted 1551
6 SASI_Hs01_00179485 predicted 1557
7 SASI_Hs01_00179486 predicted 791
8 SASI_Hs01_00179487 predicted 762
9 SASI_Hs01_00179488 predicted 2064
10 SASI_Hs01_00179489 predicted 1462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081270 predicted 1328
2 SASI_Mm01_00081272 predicted 811
3 SASI_Mm01_00081273 predicted 567
4 SASI_Mm01_00081274 predicted 908
5 SASI_Mm01_00081275 predicted 203
6 SASI_Mm02_00345519 predicted 366
7 SASI_Mm01_00081276 predicted 824
8 SASI_Mm01_00081277 predicted 390
9 SASI_Mm01_00081278 predicted 406
10 SASI_Mm01_00081279 predicted 1323
11 SASI_Mm01_00081271 predicted 1180
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_984043 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267340 predicted 465
2 SASI_Mm01_00267341 predicted 452
3 SASI_Mm01_00267342 predicted 402
4 SASI_Mm01_00267343 predicted 591
5 SASI_Mm01_00267344 predicted 525
6 SASI_Mm01_00267345 predicted 481
7 SASI_Mm01_00267346 predicted 396
8 SASI_Mm01_00267347 predicted 430
9 SASI_Mm01_00267348 predicted 318
10 SASI_Mm01_00267349 predicted 332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174875
VALIDATED
ATG4A MISSION shRNA Bacterial Glycerol Stock
autophagy related 4A, cysteine peptidase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174875.3-1312s1c1
Sequence:CCGGGCCTGATATGCAGATAGCATACTCGAGTATGCTATCTGCATATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174875.3-390s1c1
Sequence:CCGGGCAGTGTTTCCTAGATAGAAACTCGAGTTTCTATCTAGGAAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174875.3-1495s1c1
Sequence:CCGGGCAAGTCTTCAGCAATGGAAACTCGAGTTTCCATTGCTGAAGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174875.3-726s1c1
Sequence:CCGGCCTGGGCATAAACCAAATCAACTCGAGTTGATTTGGTTTATGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174875.3-1490s1c1
Sequence:CCGGCGACAGCAAGTCTTCAGCAATCTCGAGATTGCTGAAGACTTGCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174875.2-546s1c1
Sequence:CCGGGCTGTTTATGATTCCATGGATCTCGAGATCCATGGAATCATAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174875.2-1489s1c1
Sequence:CCGGCGACAGCAAGTCTTCAGCAATCTCGAGATTGCTGAAGACTTGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174875.2-112s1c1
Sequence:CCGGCGGATACAGATGAGCTGGTATCTCGAGATACCAGCTCATCTGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174875.2-824s1c1
Sequence:CCGGCGCCTATTATTTCATAGGATTCTCGAGAATCCTATGAAATAATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174875.2-1076s1c1
Sequence:CCGGGATGTTTGAATTGGTTCAGAACTCGAGTTCTGAACCAATTCAAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174875
VALIDATED
ATG4A MISSION shRNA shRNA Plasmid DNA
autophagy related 4A, cysteine peptidase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174875.3-1312s1c1
Sequence:CCGGGCCTGATATGCAGATAGCATACTCGAGTATGCTATCTGCATATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174875.3-390s1c1
Sequence:CCGGGCAGTGTTTCCTAGATAGAAACTCGAGTTTCTATCTAGGAAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174875.3-1495s1c1
Sequence:CCGGGCAAGTCTTCAGCAATGGAAACTCGAGTTTCCATTGCTGAAGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174875.3-726s1c1
Sequence:CCGGCCTGGGCATAAACCAAATCAACTCGAGTTGATTTGGTTTATGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174875.3-1490s1c1
Sequence:CCGGCGACAGCAAGTCTTCAGCAATCTCGAGATTGCTGAAGACTTGCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174875.2-546s1c1
Sequence:CCGGGCTGTTTATGATTCCATGGATCTCGAGATCCATGGAATCATAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174875.2-1489s1c1
Sequence:CCGGCGACAGCAAGTCTTCAGCAATCTCGAGATTGCTGAAGACTTGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174875.2-112s1c1
Sequence:CCGGCGGATACAGATGAGCTGGTATCTCGAGATACCAGCTCATCTGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174875.2-824s1c1
Sequence:CCGGCGCCTATTATTTCATAGGATTCTCGAGAATCCTATGAAATAATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174875.2-1076s1c1
Sequence:CCGGGATGTTTGAATTGGTTCAGAACTCGAGTTCTGAACCAATTCAAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174875
VALIDATED
ATG4A MISSION shRNA Lentiviral Transduction Particles
autophagy related 4A, cysteine peptidase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174875.3-1312s1c1
Sequence:CCGGGCCTGATATGCAGATAGCATACTCGAGTATGCTATCTGCATATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174875.3-390s1c1
Sequence:CCGGGCAGTGTTTCCTAGATAGAAACTCGAGTTTCTATCTAGGAAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174875.3-1495s1c1
Sequence:CCGGGCAAGTCTTCAGCAATGGAAACTCGAGTTTCCATTGCTGAAGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174875.3-726s1c1
Sequence:CCGGCCTGGGCATAAACCAAATCAACTCGAGTTGATTTGGTTTATGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174875.3-1490s1c1
Sequence:CCGGCGACAGCAAGTCTTCAGCAATCTCGAGATTGCTGAAGACTTGCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174875.2-546s1c1
Sequence:CCGGGCTGTTTATGATTCCATGGATCTCGAGATCCATGGAATCATAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174875.2-1489s1c1
Sequence:CCGGCGACAGCAAGTCTTCAGCAATCTCGAGATTGCTGAAGACTTGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174875.2-112s1c1
Sequence:CCGGCGGATACAGATGAGCTGGTATCTCGAGATACCAGCTCATCTGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174875.2-824s1c1
Sequence:CCGGCGCCTATTATTTCATAGGATTCTCGAGAATCCTATGAAATAATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174875.2-1076s1c1
Sequence:CCGGGATGTTTGAATTGGTTCAGAACTCGAGTTCTGAACCAATTCAAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052936
VALIDATED
ATG4A MISSION shRNA Bacterial Glycerol Stock
autophagy related 4A, cysteine peptidase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052936.2-1514s1c1
Sequence:CCGGCCCGGAAAGAAATAGAACAATCTCGAGATTGTTCTATTTCTTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_052936.2-191s1c1
Sequence:CCGGCAGATACAGATGAGCTGGTATCTCGAGATACCAGCTCATCTGTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_052936.2-190s1c1
Sequence:CCGGCCAGATACAGATGAGCTGGTACTCGAGTACCAGCTCATCTGTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052936.2-813s1c1
Sequence:CCGGCCTGGGCATAAACCAAATCAACTCGAGTTGATTTGGTTTATGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_052936.2-912s1c1
Sequence:CCGGCGCGTATTATTTCATAGGATTCTCGAGAATCCTATGAAATAATACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-715s21c1
Sequence:CCGGGACAGGCCTCCCGATTCTTTACTCGAGTAAAGAATCGGGAGGCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-1041s21c1
Sequence:CCGGACAGCGAATGAACATCCTAAACTCGAGTTTAGGATGTTCATTCGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-495s21c1
Sequence:CCGGTTGCTACTCTATCCATCAAATCTCGAGATTTGATGGATAGAGTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-375s21c1
Sequence:CCGGGATGCTGGCTCAAGCCCTTATCTCGAGATAAGGGCTTGAGCCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052936.2-1398s21c1
Sequence:CCGGTAGTCAGCAAGTGCCTGATATCTCGAGATATCAGGCACTTGCTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-264s21c1
Sequence:CCGGTGATATAAGTGCTCGTCTATGCTCGAGCATAGACGAGCACTTATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-866s21c1
Sequence:CCGGTTAAGATGCCACAGTCTTTAGCTCGAGCTAAAGACTGTGGCATCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052936
VALIDATED
ATG4A MISSION shRNA shRNA Plasmid DNA
autophagy related 4A, cysteine peptidase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052936.2-1514s1c1
Sequence:CCGGCCCGGAAAGAAATAGAACAATCTCGAGATTGTTCTATTTCTTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_052936.2-191s1c1
Sequence:CCGGCAGATACAGATGAGCTGGTATCTCGAGATACCAGCTCATCTGTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_052936.2-190s1c1
Sequence:CCGGCCAGATACAGATGAGCTGGTACTCGAGTACCAGCTCATCTGTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052936.2-813s1c1
Sequence:CCGGCCTGGGCATAAACCAAATCAACTCGAGTTGATTTGGTTTATGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_052936.2-912s1c1
Sequence:CCGGCGCGTATTATTTCATAGGATTCTCGAGAATCCTATGAAATAATACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-715s21c1
Sequence:CCGGGACAGGCCTCCCGATTCTTTACTCGAGTAAAGAATCGGGAGGCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-1041s21c1
Sequence:CCGGACAGCGAATGAACATCCTAAACTCGAGTTTAGGATGTTCATTCGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-495s21c1
Sequence:CCGGTTGCTACTCTATCCATCAAATCTCGAGATTTGATGGATAGAGTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-375s21c1
Sequence:CCGGGATGCTGGCTCAAGCCCTTATCTCGAGATAAGGGCTTGAGCCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052936.2-1398s21c1
Sequence:CCGGTAGTCAGCAAGTGCCTGATATCTCGAGATATCAGGCACTTGCTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-264s21c1
Sequence:CCGGTGATATAAGTGCTCGTCTATGCTCGAGCATAGACGAGCACTTATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-866s21c1
Sequence:CCGGTTAAGATGCCACAGTCTTTAGCTCGAGCTAAAGACTGTGGCATCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052936
VALIDATED
ATG4A MISSION shRNA Lentiviral Transduction Particles
autophagy related 4A, cysteine peptidase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052936.2-1514s1c1
Sequence:CCGGCCCGGAAAGAAATAGAACAATCTCGAGATTGTTCTATTTCTTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_052936.2-191s1c1
Sequence:CCGGCAGATACAGATGAGCTGGTATCTCGAGATACCAGCTCATCTGTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_052936.2-190s1c1
Sequence:CCGGCCAGATACAGATGAGCTGGTACTCGAGTACCAGCTCATCTGTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052936.2-813s1c1
Sequence:CCGGCCTGGGCATAAACCAAATCAACTCGAGTTGATTTGGTTTATGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_052936.2-912s1c1
Sequence:CCGGCGCGTATTATTTCATAGGATTCTCGAGAATCCTATGAAATAATACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-715s21c1
Sequence:CCGGGACAGGCCTCCCGATTCTTTACTCGAGTAAAGAATCGGGAGGCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-1041s21c1
Sequence:CCGGACAGCGAATGAACATCCTAAACTCGAGTTTAGGATGTTCATTCGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-495s21c1
Sequence:CCGGTTGCTACTCTATCCATCAAATCTCGAGATTTGATGGATAGAGTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-375s21c1
Sequence:CCGGGATGCTGGCTCAAGCCCTTATCTCGAGATAAGGGCTTGAGCCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052936.2-1398s21c1
Sequence:CCGGTAGTCAGCAAGTGCCTGATATCTCGAGATATCAGGCACTTGCTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-264s21c1
Sequence:CCGGTGATATAAGTGCTCGTCTATGCTCGAGCATAGACGAGCACTTATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052936.2-866s21c1
Sequence:CCGGTTAAGATGCCACAGTCTTTAGCTCGAGCTAAAGACTGTGGCATCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks