EMAIL THIS PAGE TO A FRIEND

ATG4B

autophagy related 4B, cysteine peptidase

70 Gene Product Result for
Synonyms: APG4B AUTL1
Gene ID:
Human(23192) Summary: Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(66615) autophagy related 4B, cysteine peptidase
Rat(316640) autophagy related 4B, cysteine peptidase
domestic guinea pig(100730562) autophagy related 4B, cysteine peptidase
naked mole-rat(101719832) autophagy related 4B, cysteine peptidase
sheep(101122243) autophagy related 4B, cysteine peptidase
Zebrafish(448859) ATG4 autophagy related 4 homolog B (S. cerevisiae)
cow(408002) autophagy related 4B, cysteine peptidase
Horse(100067797) autophagy related 4B, cysteine peptidase
domestic cat(101097334) autophagy related 4B, cysteine peptidase
dog(609599) autophagy related 4B, cysteine peptidase
chicken(404750) ATG4 autophagy related 4 homolog B (S. cerevisiae)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013325 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174874 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174874 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174874 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013325 Rosetta Predictions human pricing
NM_178326 Rosetta Predictions human pricing
NM_001025711 Rosetta Predictions rat pricing
NM_174874 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126888 predicted 467
2 SASI_Hs01_00126889 predicted 520
3 SASI_Hs01_00126890 predicted 1615
4 SASI_Hs01_00126891 predicted 238
5 SASI_Hs01_00126892 predicted 872
6 SASI_Hs01_00126893 predicted 822
7 SASI_Hs01_00126894 predicted 560
8 SASI_Hs01_00126895 predicted 383
9 SASI_Hs01_00126896 predicted 708
10 SASI_Hs01_00126897 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240486 predicted 467
2 SASI_Hs01_00240487 predicted 518
3 SASI_Hs01_00240488 predicted 1635
4 SASI_Hs01_00240489 predicted 233
5 SASI_Hs01_00240490 predicted 876
6 SASI_Hs01_00240491 predicted 822
7 SASI_Hs01_00240492 predicted 560
8 SASI_Hs01_00240493 predicted 384
9 SASI_Hs01_00240494 predicted 707
10 SASI_Hs01_00240495 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025711 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077870 predicted 968
2 SASI_Rn01_00077871 predicted 703
3 SASI_Rn01_00077872 predicted 446
4 SASI_Rn01_00077873 predicted 949
5 SASI_Rn02_00203334 predicted 312
6 SASI_Rn01_00077874 predicted 357
7 SASI_Rn01_00077875 predicted 243
8 SASI_Rn02_00203335 predicted 633
9 SASI_Rn01_00077877 predicted 368
10 SASI_Rn02_00203336 predicted 1020
11 SASI_Rn01_00077876 predicted 316
12 SASI_Rn01_00077878 predicted 394
13 SASI_Rn01_00077879 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159388 predicted 1170
2 SASI_Mm01_00159389 predicted 1050
3 SASI_Mm01_00159390 predicted 595
4 SASI_Mm01_00159392 predicted 791
5 SASI_Mm01_00159393 predicted 474
6 SASI_Mm01_00159394 predicted 322
7 SASI_Mm02_00345517 predicted 501
8 SASI_Mm01_00159395 predicted 504
9 SASI_Mm01_00159396 predicted 970
10 SASI_Mm02_00345518 predicted 701
11 SASI_Mm01_00159387 predicted 378
12 SASI_Mm01_00159391 predicted 800
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013325
VALIDATED
ATG4B MISSION shRNA Bacterial Glycerol Stock
autophagy related 4B, cysteine peptidase
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013325.4-1647s21c1
Sequence:CCGGGTCAGACACAGACATGAATTTCTCGAGAAATTCATGTCTGTGTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-475s21c1
Sequence:CCGGCATTCACCAGATAGCGCAAATCTCGAGATTTGCGCTATCTGGTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013325.4-235s21c1
Sequence:CCGGTGATGTGGCATCTAGACTTTGCTCGAGCAAAGTCTAGATGCCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-430s21c1
Sequence:CCGGCAGCGTCCTCAACGCATTCATCTCGAGATGAATGCGTTGAGGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-562s21c1
Sequence:CCGGGAAGCTTGCTGTCTTCGATACCTCGAGGTATCGAAGACAGCAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-1612s21c1
Sequence:CCGGGTGGTTGGTTTGGAATTAAAGCTCGAGCTTTAATTCCAAACCAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-1195s21c1
Sequence:CCGGCCTGAACCTGTCCCTAGATTCCTCGAGGAATCTAGGGACAGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-333s21c1
Sequence:CCGGGGTGTGGACAGATGATCTTTGCTCGAGCAAAGATCATCTGTCCACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013325.3-116s1c1
Sequence:CCGGCCGTTTGGATACTGGGTAGAACTCGAGTTCTACCCAGTATCCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013325.3-1174s1c1
Sequence:CCGGGAAAGATTCTTCGACTCAGAACTCGAGTTCTGAGTCGAAGAATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013325.3-832s1c1
Sequence:CCGGCACTACTTCATCGGCTACGTTCTCGAGAACGTAGCCGATGAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013325.3-76s1c1
Sequence:CCGGCGGTTTGCTGAGTTTGAAGATCTCGAGATCTTCAAACTCAGCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013325.3-271s1c1
Sequence:CCGGCGGTGTGGACAGATGATCTTTCTCGAGAAAGATCATCTGTCCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013325
VALIDATED
ATG4B MISSION shRNA shRNA Plasmid DNA
autophagy related 4B, cysteine peptidase
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013325.4-1647s21c1
Sequence:CCGGGTCAGACACAGACATGAATTTCTCGAGAAATTCATGTCTGTGTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-475s21c1
Sequence:CCGGCATTCACCAGATAGCGCAAATCTCGAGATTTGCGCTATCTGGTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013325.4-235s21c1
Sequence:CCGGTGATGTGGCATCTAGACTTTGCTCGAGCAAAGTCTAGATGCCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-430s21c1
Sequence:CCGGCAGCGTCCTCAACGCATTCATCTCGAGATGAATGCGTTGAGGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-562s21c1
Sequence:CCGGGAAGCTTGCTGTCTTCGATACCTCGAGGTATCGAAGACAGCAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-1612s21c1
Sequence:CCGGGTGGTTGGTTTGGAATTAAAGCTCGAGCTTTAATTCCAAACCAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-1195s21c1
Sequence:CCGGCCTGAACCTGTCCCTAGATTCCTCGAGGAATCTAGGGACAGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-333s21c1
Sequence:CCGGGGTGTGGACAGATGATCTTTGCTCGAGCAAAGATCATCTGTCCACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013325.3-116s1c1
Sequence:CCGGCCGTTTGGATACTGGGTAGAACTCGAGTTCTACCCAGTATCCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013325.3-1174s1c1
Sequence:CCGGGAAAGATTCTTCGACTCAGAACTCGAGTTCTGAGTCGAAGAATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013325.3-832s1c1
Sequence:CCGGCACTACTTCATCGGCTACGTTCTCGAGAACGTAGCCGATGAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013325.3-76s1c1
Sequence:CCGGCGGTTTGCTGAGTTTGAAGATCTCGAGATCTTCAAACTCAGCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013325.3-271s1c1
Sequence:CCGGCGGTGTGGACAGATGATCTTTCTCGAGAAAGATCATCTGTCCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013325
VALIDATED
ATG4B MISSION shRNA Lentiviral Transduction Particles
autophagy related 4B, cysteine peptidase
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013325.4-1647s21c1
Sequence:CCGGGTCAGACACAGACATGAATTTCTCGAGAAATTCATGTCTGTGTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-475s21c1
Sequence:CCGGCATTCACCAGATAGCGCAAATCTCGAGATTTGCGCTATCTGGTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013325.4-235s21c1
Sequence:CCGGTGATGTGGCATCTAGACTTTGCTCGAGCAAAGTCTAGATGCCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-430s21c1
Sequence:CCGGCAGCGTCCTCAACGCATTCATCTCGAGATGAATGCGTTGAGGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-562s21c1
Sequence:CCGGGAAGCTTGCTGTCTTCGATACCTCGAGGTATCGAAGACAGCAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-1612s21c1
Sequence:CCGGGTGGTTGGTTTGGAATTAAAGCTCGAGCTTTAATTCCAAACCAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-1195s21c1
Sequence:CCGGCCTGAACCTGTCCCTAGATTCCTCGAGGAATCTAGGGACAGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013325.4-333s21c1
Sequence:CCGGGGTGTGGACAGATGATCTTTGCTCGAGCAAAGATCATCTGTCCACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013325.3-116s1c1
Sequence:CCGGCCGTTTGGATACTGGGTAGAACTCGAGTTCTACCCAGTATCCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013325.3-1174s1c1
Sequence:CCGGGAAAGATTCTTCGACTCAGAACTCGAGTTCTGAGTCGAAGAATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013325.3-832s1c1
Sequence:CCGGCACTACTTCATCGGCTACGTTCTCGAGAACGTAGCCGATGAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013325.3-76s1c1
Sequence:CCGGCGGTTTGCTGAGTTTGAAGATCTCGAGATCTTCAAACTCAGCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013325.3-271s1c1
Sequence:CCGGCGGTGTGGACAGATGATCTTTCTCGAGAAAGATCATCTGTCCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174874
VALIDATED
ATG4B MISSION shRNA Bacterial Glycerol Stock
autophagy related 4B, cysteine peptidase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174874.3-500s21c1
Sequence:CCGGCCTTGGCTGTTCACATAGCAACTCGAGTTGCTATGTGAACAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174874.3-130s21c1
Sequence:CCGGGACGAAATCTTGTCTGATGTTCTCGAGAACATCAGACAAGATTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174874.3-1051s21c1
Sequence:CCGGCCCATGTTTGAGCTGGTGGAACTCGAGTTCCACCAGCTCAAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174874.3-383s21c1
Sequence:CCGGCCATCCATCAGATAGCGCAAACTCGAGTTTGCGCTATCTGATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174874.1-800s1c1
Sequence:CCGGGCCCACTACTTTATTGGCTATCTCGAGATAGCCAATAAAGTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174874.1-384s1c1
Sequence:CCGGCCATCCATCAGATAGCGCAAACTCGAGTTTGCGCTATCTGATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174874.1-501s1c1
Sequence:CCGGCCTTGGCTGTTCACATAGCAACTCGAGTTGCTATGTGAACAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174874.1-1052s1c1
Sequence:CCGGCCCATGTTTGAGCTGGTGGAACTCGAGTTCCACCAGCTCAAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174874.1-131s1c1
Sequence:CCGGGACGAAATCTTGTCTGATGTTCTCGAGAACATCAGACAAGATTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174874
VALIDATED
ATG4B MISSION shRNA shRNA Plasmid DNA
autophagy related 4B, cysteine peptidase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174874.3-500s21c1
Sequence:CCGGCCTTGGCTGTTCACATAGCAACTCGAGTTGCTATGTGAACAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174874.3-130s21c1
Sequence:CCGGGACGAAATCTTGTCTGATGTTCTCGAGAACATCAGACAAGATTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174874.3-1051s21c1
Sequence:CCGGCCCATGTTTGAGCTGGTGGAACTCGAGTTCCACCAGCTCAAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174874.3-383s21c1
Sequence:CCGGCCATCCATCAGATAGCGCAAACTCGAGTTTGCGCTATCTGATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174874.1-800s1c1
Sequence:CCGGGCCCACTACTTTATTGGCTATCTCGAGATAGCCAATAAAGTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174874.1-384s1c1
Sequence:CCGGCCATCCATCAGATAGCGCAAACTCGAGTTTGCGCTATCTGATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174874.1-501s1c1
Sequence:CCGGCCTTGGCTGTTCACATAGCAACTCGAGTTGCTATGTGAACAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174874.1-1052s1c1
Sequence:CCGGCCCATGTTTGAGCTGGTGGAACTCGAGTTCCACCAGCTCAAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174874.1-131s1c1
Sequence:CCGGGACGAAATCTTGTCTGATGTTCTCGAGAACATCAGACAAGATTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174874
VALIDATED
ATG4B MISSION shRNA Lentiviral Transduction Particles
autophagy related 4B, cysteine peptidase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174874.3-500s21c1
Sequence:CCGGCCTTGGCTGTTCACATAGCAACTCGAGTTGCTATGTGAACAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174874.3-130s21c1
Sequence:CCGGGACGAAATCTTGTCTGATGTTCTCGAGAACATCAGACAAGATTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174874.3-1051s21c1
Sequence:CCGGCCCATGTTTGAGCTGGTGGAACTCGAGTTCCACCAGCTCAAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174874.3-383s21c1
Sequence:CCGGCCATCCATCAGATAGCGCAAACTCGAGTTTGCGCTATCTGATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174874.1-800s1c1
Sequence:CCGGGCCCACTACTTTATTGGCTATCTCGAGATAGCCAATAAAGTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174874.1-384s1c1
Sequence:CCGGCCATCCATCAGATAGCGCAAACTCGAGTTTGCGCTATCTGATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174874.1-501s1c1
Sequence:CCGGCCTTGGCTGTTCACATAGCAACTCGAGTTGCTATGTGAACAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174874.1-1052s1c1
Sequence:CCGGCCCATGTTTGAGCTGGTGGAACTCGAGTTCCACCAGCTCAAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174874.1-131s1c1
Sequence:CCGGGACGAAATCTTGTCTGATGTTCTCGAGAACATCAGACAAGATTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks