EMAIL THIS PAGE TO A FRIEND

ATG4C

autophagy related 4C, cysteine peptidase

Synonyms: APG4-C APG4C AUTL1 AUTL3
UniProtKB ID: Q96DT6, A6NLR8, D3DQ58, Q96K04
Gene ID:
Human(84938) Summary: Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. Alternate transcriptional splice variants, encoding the same protein, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(242557) autophagy related 4C, cysteine peptidase
Rat(313391) autophagy related 4C, cysteine peptidase
Zebrafish(415193) autophagy-related 4C (yeast)
cow(531455) ATG4 autophagy related 4 homolog C (S. cerevisiae)
Horse(100054106) autophagy related 4C, cysteine peptidase
domestic cat(101081652) autophagy related 4C, cysteine peptidase
dog(489561) autophagy related 4C, cysteine peptidase
chicken(424688) autophagy related 4C, cysteine peptidase
sheep(101108002) autophagy related 4C, cysteine peptidase
Domestic Rabbit(100357847) autophagy related 4C, cysteine peptidase
naked mole-rat(101713656) autophagy related 4C, cysteine peptidase
domestic guinea pig(100729416) autophagy related 4C, cysteine peptidase
Gene Class: Cytoskeleton
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032852 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175029 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175029 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175029 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032852 Rosetta Predictions human pricing
NM_178221 Rosetta Predictions human pricing
NM_001107948 Rosetta Predictions rat pricing
NM_175029 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075254 predicted 1035
2 SASI_Hs01_00075255 predicted 1056
3 SASI_Hs01_00075256 predicted 1193
4 SASI_Hs02_00360446 predicted 781
5 SASI_Hs02_00360447 predicted 1225
6 SASI_Hs01_00075258 predicted 1169
7 SASI_Hs02_00360448 predicted 1388
8 SASI_Hs01_00075260 predicted 846
9 SASI_Hs01_00075261 predicted 1152
10 SASI_Hs01_00075262 predicted 1471
11 SASI_Hs01_00075257 predicted 1245
12 SASI_Hs01_00075259 predicted 1562
13 SASI_Hs01_00075263 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176850 predicted 995
2 SASI_Hs01_00176851 predicted 1009
3 SASI_Hs01_00176852 predicted 1144
4 SASI_Hs02_00369597 predicted 735
5 SASI_Hs01_00176853 predicted 1175
6 SASI_Hs01_00176855 predicted 1121
7 SASI_Hs02_00369598 predicted 1337
8 SASI_Hs01_00176856 predicted 794
9 SASI_Hs01_00176857 predicted 1104
10 SASI_Hs02_00369599 predicted 1415
11 SASI_Hs01_00176854 predicted 1197
12 SASI_Hs01_00176858 predicted 525
13 SASI_Hs01_00176859 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107948 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233865 predicted 1334
2 SASI_Rn02_00233866 predicted 1595
3 SASI_Rn02_00233867 predicted 1190
4 SASI_Rn02_00233868 predicted 1657
5 SASI_Rn02_00233869 predicted 1574
6 SASI_Rn02_00233870 predicted 1790
7 SASI_Rn02_00233871 predicted 630
8 SASI_Rn02_00233872 predicted 1358
9 SASI_Rn02_00233873 predicted 1071
10 SASI_Rn02_00233874 predicted 1470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021602 predicted 1327
2 SASI_Mm01_00021604 predicted 1514
3 SASI_Mm01_00021605 predicted 1364
4 SASI_Mm01_00021606 predicted 1792
5 SASI_Mm01_00021607 predicted 768
6 SASI_Mm02_00345634 predicted 1156
7 SASI_Mm01_00021609 predicted 1497
8 SASI_Mm01_00021610 predicted 1713
9 SASI_Mm01_00021611 predicted 1935
10 SASI_Mm02_00345635 predicted 2029
11 SASI_Mm01_00021603 predicted 1484
12 SASI_Mm01_00021608 predicted 1606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032852
VALIDATED
ATG4C MISSION shRNA Bacterial Glycerol Stock
autophagy related 4C, cysteine peptidase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032852.2-685s1c1
Sequence:CCGGGCATCATTTGAAGCATCACTTCTCGAGAAGTGATGCTTCAAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032852.2-1604s1c1
Sequence:CCGGGCTTGATAAGAAGAATTCCATCTCGAGATGGAATTCTTCTTATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032852.2-611s1c1
Sequence:CCGGCCTGGCCTGATGCTTTGAATACTCGAGTATTCAAAGCATCAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032852.2-1155s1c1
Sequence:CCGGCCTGGAATATTGTGTGGGTATCTCGAGATACCCACACAATATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032852.2-1154s1c1
Sequence:CCGGGCCTGGAATATTGTGTGGGTACTCGAGTACCCACACAATATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032852.2-783s21c1
Sequence:CCGGGCGAAATGAAGTTTATCATAGCTCGAGCTATGATAAACTTCATTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032852.2-1473s21c1
Sequence:CCGGTCATTCCAGAGACTATGATTTCTCGAGAAATCATAGTCTCTGGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032852.2-1063s21c1
Sequence:CCGGGATGACAAAGCTGTTATTATTCTCGAGAATAATAACAGCTTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032852.2-959s21c1
Sequence:CCGGATCCTGATTTACAAGGAATAACTCGAGTTATTCCTTGTAAATCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032852.2-990s21c1
Sequence:CCGGTGCACAAGATTGTACAGTTTACTCGAGTAAACTGTACAATCTTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032852
VALIDATED
ATG4C MISSION shRNA shRNA Plasmid DNA
autophagy related 4C, cysteine peptidase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032852.2-685s1c1
Sequence:CCGGGCATCATTTGAAGCATCACTTCTCGAGAAGTGATGCTTCAAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032852.2-1604s1c1
Sequence:CCGGGCTTGATAAGAAGAATTCCATCTCGAGATGGAATTCTTCTTATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032852.2-611s1c1
Sequence:CCGGCCTGGCCTGATGCTTTGAATACTCGAGTATTCAAAGCATCAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032852.2-1155s1c1
Sequence:CCGGCCTGGAATATTGTGTGGGTATCTCGAGATACCCACACAATATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032852.2-1154s1c1
Sequence:CCGGGCCTGGAATATTGTGTGGGTACTCGAGTACCCACACAATATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032852.2-783s21c1
Sequence:CCGGGCGAAATGAAGTTTATCATAGCTCGAGCTATGATAAACTTCATTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032852.2-1473s21c1
Sequence:CCGGTCATTCCAGAGACTATGATTTCTCGAGAAATCATAGTCTCTGGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032852.2-1063s21c1
Sequence:CCGGGATGACAAAGCTGTTATTATTCTCGAGAATAATAACAGCTTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032852.2-959s21c1
Sequence:CCGGATCCTGATTTACAAGGAATAACTCGAGTTATTCCTTGTAAATCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032852.2-990s21c1
Sequence:CCGGTGCACAAGATTGTACAGTTTACTCGAGTAAACTGTACAATCTTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032852
VALIDATED
ATG4C MISSION shRNA Lentiviral Transduction Particles
autophagy related 4C, cysteine peptidase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032852.2-685s1c1
Sequence:CCGGGCATCATTTGAAGCATCACTTCTCGAGAAGTGATGCTTCAAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032852.2-1604s1c1
Sequence:CCGGGCTTGATAAGAAGAATTCCATCTCGAGATGGAATTCTTCTTATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032852.2-611s1c1
Sequence:CCGGCCTGGCCTGATGCTTTGAATACTCGAGTATTCAAAGCATCAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032852.2-1155s1c1
Sequence:CCGGCCTGGAATATTGTGTGGGTATCTCGAGATACCCACACAATATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032852.2-1154s1c1
Sequence:CCGGGCCTGGAATATTGTGTGGGTACTCGAGTACCCACACAATATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032852.2-783s21c1
Sequence:CCGGGCGAAATGAAGTTTATCATAGCTCGAGCTATGATAAACTTCATTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032852.2-1473s21c1
Sequence:CCGGTCATTCCAGAGACTATGATTTCTCGAGAAATCATAGTCTCTGGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032852.2-1063s21c1
Sequence:CCGGGATGACAAAGCTGTTATTATTCTCGAGAATAATAACAGCTTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032852.2-959s21c1
Sequence:CCGGATCCTGATTTACAAGGAATAACTCGAGTTATTCCTTGTAAATCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032852.2-990s21c1
Sequence:CCGGTGCACAAGATTGTACAGTTTACTCGAGTAAACTGTACAATCTTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175029
ATG4C MISSION shRNA Bacterial Glycerol Stock
autophagy related 4C, cysteine peptidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175029.2-1523s1c1
Sequence:CCGGCCTTGAATACTGTGTAGGTATCTCGAGATACCTACACAGTATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175029.2-1550s1c1
Sequence:CCGGCGGCAAACCTAAACAGTCATACTCGAGTATGACTGTTTAGGTTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175029.2-1840s1c1
Sequence:CCGGGCCATTCCAAAGACTTTGATTCTCGAGAATCAAAGTCTTTGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175029.2-647s1c1
Sequence:CCGGGAAATATAGTTGGGTGTTGAACTCGAGTTCAACACCCAACTATATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175029.2-774s1c1
Sequence:CCGGGCCATTGAAGATCATGTAATTCTCGAGAATTACATGATCTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175029
ATG4C MISSION shRNA shRNA Plasmid DNA
autophagy related 4C, cysteine peptidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175029.2-1523s1c1
Sequence:CCGGCCTTGAATACTGTGTAGGTATCTCGAGATACCTACACAGTATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175029.2-1550s1c1
Sequence:CCGGCGGCAAACCTAAACAGTCATACTCGAGTATGACTGTTTAGGTTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175029.2-1840s1c1
Sequence:CCGGGCCATTCCAAAGACTTTGATTCTCGAGAATCAAAGTCTTTGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175029.2-647s1c1
Sequence:CCGGGAAATATAGTTGGGTGTTGAACTCGAGTTCAACACCCAACTATATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175029.2-774s1c1
Sequence:CCGGGCCATTGAAGATCATGTAATTCTCGAGAATTACATGATCTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175029
ATG4C MISSION shRNA Lentiviral Transduction Particles
autophagy related 4C, cysteine peptidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175029.2-1523s1c1
Sequence:CCGGCCTTGAATACTGTGTAGGTATCTCGAGATACCTACACAGTATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175029.2-1550s1c1
Sequence:CCGGCGGCAAACCTAAACAGTCATACTCGAGTATGACTGTTTAGGTTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175029.2-1840s1c1
Sequence:CCGGGCCATTCCAAAGACTTTGATTCTCGAGAATCAAAGTCTTTGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175029.2-647s1c1
Sequence:CCGGGAAATATAGTTGGGTGTTGAACTCGAGTTCAACACCCAACTATATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175029.2-774s1c1
Sequence:CCGGGCCATTGAAGATCATGTAATTCTCGAGAATTACATGATCTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks