EMAIL THIS PAGE TO A FRIEND

ATG4D

autophagy related 4D, cysteine peptidase

91 Gene Product Result for
Synonyms: APG4-D APG4D AUTL4
UniProtKB ID: Q86TL0
Gene ID:
Human(84971) Summary: Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. [provided by RefSeq, Jul 2008]
Mouse(235040) autophagy related 4D, cysteine peptidase
Rat(686505) autophagy related 4D, cysteine peptidase
domestic guinea pig(100716859) autophagy related 4D, cysteine peptidase
naked mole-rat(101719929) autophagy related 4D, cysteine peptidase
sheep(101118272) autophagy related 4D, cysteine peptidase
cow(615657) ATG4 autophagy related 4 homolog D (S. cerevisiae)
Horse(100057841) autophagy related 4D, cysteine peptidase
domestic cat(101094737) autophagy related 4D, cysteine peptidase
dog(484953) autophagy related 4D, cysteine peptidase
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302274 ANTI-APG4D (CENTER S341) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1301450 ANTI-ATG4D (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1301451 ANTI-ATG4D (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1301449 ANTI-ATG4D (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB1302275 ANTI-ATG4D (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1302744 ANTI-ATG4D (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1301447 ANTI-ATG4D (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
immunohistochemistry, western blot pricing
SAB1301448 ANTI-ATG4D (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB1302743 ANTI-ATG4D (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB2700038 Anti-ATG4D antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2107349 Anti-ATG4D antibody produced in rabbit affinity isolated antibody human, guinea pig, rabbit
ELISA, western blot pricing
HPA067683 Anti-ATG4D antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1301246 ANTI-ATG4D antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB1302740 ANTI-ATG4D antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1302741 ANTI-ATG4D antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1302742 ANTI-ATG4D antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1302800 ANTI-PHOSPHO-ATG4D-S15 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
pricing
SAB1302801 ANTI-PHOSPHO-ATG4D-S341 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
pricing
SAB1302802 ANTI-PHOSPHO-ATG4D-S467 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032885 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153583 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153583 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153583 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035721 MISSION® esiRNA esiRNA human ATG4D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032885 Rosetta Predictions human pricing
NM_001101013 Rosetta Predictions rat pricing
NM_153583 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023430 predicted 562
2 SASI_Hs01_00023431 predicted 1061
3 SASI_Hs01_00023432 predicted 1285
4 SASI_Hs01_00023433 predicted 415
5 SASI_Hs01_00023434 predicted 748
6 SASI_Hs01_00023435 predicted 845
7 SASI_Hs01_00023437 predicted 1138
8 SASI_Hs01_00023438 predicted 1003
9 SASI_Hs01_00023439 predicted 1179
10 SASI_Hs02_00360508 predicted 893
11 SASI_Hs01_00023436 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211256 predicted 911
2 SASI_Rn02_00211257 predicted 919
3 SASI_Rn02_00211258 predicted 502
4 SASI_Rn02_00211259 predicted 486
5 SASI_Rn02_00211260 predicted 917
6 SASI_Rn02_00211261 predicted 503
7 SASI_Rn02_00211262 predicted 481
8 SASI_Rn02_00211263 predicted 508
9 SASI_Rn02_00211264 predicted 489
10 SASI_Rn02_00211265 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101046 predicted 411
2 SASI_Mm01_00101047 predicted 1898
3 SASI_Mm01_00101048 predicted 1196
4 SASI_Mm01_00101050 predicted 1614
5 SASI_Mm01_00101051 predicted 1725
6 SASI_Mm02_00343397 predicted 406
7 SASI_Mm01_00101053 predicted 525
8 SASI_Mm02_00343398 predicted 620
9 SASI_Mm01_00101054 predicted 1816
10 SASI_Mm01_00101055 predicted 1881
11 SASI_Mm01_00101049 predicted 972
12 SASI_Mm01_00101052 predicted 867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032885
ATG4D MISSION shRNA Bacterial Glycerol Stock
autophagy related 4D, cysteine peptidase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032885.4-1598s21c1
Sequence:CCGGATGTCGGGTGTGGGATCTTGACTCGAGTCAAGATCCCACACCCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032885.4-952s21c1
Sequence:CCGGACAGTGTACAAGGCGGATGTGCTCGAGCACATCCGCCTTGTACACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032885.4-330s21c1
Sequence:CCGGGACAGCCTGGAACAACGTCAACTCGAGTTGACGTTGTTCCAGGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032885.4-1622s1c1
Sequence:CCGGCTGGCAGTGATGATGGTACTTCTCGAGAAGTACCATCATCACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032885.4-1005s1c1
Sequence:CCGGCGAGTGGAAGTCTGTGGTCATCTCGAGATGACCACAGACTTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032885.4-435s1c1
Sequence:CCGGCGAGGGTGACATACAGCGTTTCTCGAGAAACGCTGTATGTCACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032885.4-1135s1c1
Sequence:CCGGCGACACTCACTGTACTTCATTCTCGAGAATGAAGTACAGTGAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032885.4-1134s1c1
Sequence:CCGGGCGACACTCACTGTACTTCATCTCGAGATGAAGTACAGTGAGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032885
ATG4D MISSION shRNA shRNA Plasmid DNA
autophagy related 4D, cysteine peptidase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032885.4-1598s21c1
Sequence:CCGGATGTCGGGTGTGGGATCTTGACTCGAGTCAAGATCCCACACCCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032885.4-952s21c1
Sequence:CCGGACAGTGTACAAGGCGGATGTGCTCGAGCACATCCGCCTTGTACACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032885.4-330s21c1
Sequence:CCGGGACAGCCTGGAACAACGTCAACTCGAGTTGACGTTGTTCCAGGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032885.4-1622s1c1
Sequence:CCGGCTGGCAGTGATGATGGTACTTCTCGAGAAGTACCATCATCACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032885.4-1005s1c1
Sequence:CCGGCGAGTGGAAGTCTGTGGTCATCTCGAGATGACCACAGACTTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032885.4-435s1c1
Sequence:CCGGCGAGGGTGACATACAGCGTTTCTCGAGAAACGCTGTATGTCACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032885.4-1135s1c1
Sequence:CCGGCGACACTCACTGTACTTCATTCTCGAGAATGAAGTACAGTGAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032885.4-1134s1c1
Sequence:CCGGGCGACACTCACTGTACTTCATCTCGAGATGAAGTACAGTGAGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032885
ATG4D MISSION shRNA Lentiviral Transduction Particles
autophagy related 4D, cysteine peptidase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032885.4-1598s21c1
Sequence:CCGGATGTCGGGTGTGGGATCTTGACTCGAGTCAAGATCCCACACCCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032885.4-952s21c1
Sequence:CCGGACAGTGTACAAGGCGGATGTGCTCGAGCACATCCGCCTTGTACACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032885.4-330s21c1
Sequence:CCGGGACAGCCTGGAACAACGTCAACTCGAGTTGACGTTGTTCCAGGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032885.4-1622s1c1
Sequence:CCGGCTGGCAGTGATGATGGTACTTCTCGAGAAGTACCATCATCACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032885.4-1005s1c1
Sequence:CCGGCGAGTGGAAGTCTGTGGTCATCTCGAGATGACCACAGACTTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032885.4-435s1c1
Sequence:CCGGCGAGGGTGACATACAGCGTTTCTCGAGAAACGCTGTATGTCACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032885.4-1135s1c1
Sequence:CCGGCGACACTCACTGTACTTCATTCTCGAGAATGAAGTACAGTGAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032885.4-1134s1c1
Sequence:CCGGGCGACACTCACTGTACTTCATCTCGAGATGAAGTACAGTGAGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153583
VALIDATED
ATG4D MISSION shRNA Bacterial Glycerol Stock
autophagy related 4D, cysteine peptidase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153583.9-1885s21c1
Sequence:CCGGAGAACTGACTGTGGCTGATAACTCGAGTTATCAGCCACAGTCAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153583.9-536s21c1
Sequence:CCGGTCTCGACTATGGCTCACATATCTCGAGATATGTGAGCCATAGTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153583.9-1805s21c1
Sequence:CCGGGCACTCACTCAGGGCCTAATTCTCGAGAATTAGGCCCTGAGTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153583.9-1623s21c1
Sequence:CCGGGGAAAGATGCCAGACTATTTACTCGAGTAAATAGTCTGGCATCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153583.8-622s1c1
Sequence:CCGGGTTACGAAGTGGTCAGATGATCTCGAGATCATCTGACCACTTCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153583.8-515s1c1
Sequence:CCGGCAGCGGTTTCAAAGGGACTTTCTCGAGAAAGTCCCTTTGAAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153583.8-1202s1c1
Sequence:CCGGCGGCATTCACTGTACTTCATTCTCGAGAATGAAGTACAGTGAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153583.8-401s1c1
Sequence:CCGGGCCTGGAACAACGTCAAGTATCTCGAGATACTTGACGTTGTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153583.8-2061s1c1
Sequence:CCGGGCTTAGTTGTAGAGGCAGGTTCTCGAGAACCTGCCTCTACAACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153583
VALIDATED
ATG4D MISSION shRNA shRNA Plasmid DNA
autophagy related 4D, cysteine peptidase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153583.9-1885s21c1
Sequence:CCGGAGAACTGACTGTGGCTGATAACTCGAGTTATCAGCCACAGTCAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153583.9-536s21c1
Sequence:CCGGTCTCGACTATGGCTCACATATCTCGAGATATGTGAGCCATAGTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153583.9-1805s21c1
Sequence:CCGGGCACTCACTCAGGGCCTAATTCTCGAGAATTAGGCCCTGAGTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153583.9-1623s21c1
Sequence:CCGGGGAAAGATGCCAGACTATTTACTCGAGTAAATAGTCTGGCATCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153583.8-622s1c1
Sequence:CCGGGTTACGAAGTGGTCAGATGATCTCGAGATCATCTGACCACTTCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153583.8-515s1c1
Sequence:CCGGCAGCGGTTTCAAAGGGACTTTCTCGAGAAAGTCCCTTTGAAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153583.8-1202s1c1
Sequence:CCGGCGGCATTCACTGTACTTCATTCTCGAGAATGAAGTACAGTGAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153583.8-401s1c1
Sequence:CCGGGCCTGGAACAACGTCAAGTATCTCGAGATACTTGACGTTGTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153583.8-2061s1c1
Sequence:CCGGGCTTAGTTGTAGAGGCAGGTTCTCGAGAACCTGCCTCTACAACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153583
VALIDATED
ATG4D MISSION shRNA Lentiviral Transduction Particles
autophagy related 4D, cysteine peptidase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153583.9-1885s21c1
Sequence:CCGGAGAACTGACTGTGGCTGATAACTCGAGTTATCAGCCACAGTCAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153583.9-536s21c1
Sequence:CCGGTCTCGACTATGGCTCACATATCTCGAGATATGTGAGCCATAGTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153583.9-1805s21c1
Sequence:CCGGGCACTCACTCAGGGCCTAATTCTCGAGAATTAGGCCCTGAGTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153583.9-1623s21c1
Sequence:CCGGGGAAAGATGCCAGACTATTTACTCGAGTAAATAGTCTGGCATCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153583.8-622s1c1
Sequence:CCGGGTTACGAAGTGGTCAGATGATCTCGAGATCATCTGACCACTTCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153583.8-515s1c1
Sequence:CCGGCAGCGGTTTCAAAGGGACTTTCTCGAGAAAGTCCCTTTGAAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153583.8-1202s1c1
Sequence:CCGGCGGCATTCACTGTACTTCATTCTCGAGAATGAAGTACAGTGAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153583.8-401s1c1
Sequence:CCGGGCCTGGAACAACGTCAAGTATCTCGAGATACTTGACGTTGTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153583.8-2061s1c1
Sequence:CCGGGCTTAGTTGTAGAGGCAGGTTCTCGAGAACCTGCCTCTACAACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks