EMAIL THIS PAGE TO A FRIEND

ATG5

autophagy related 5

156 Gene Product Result for
Synonyms: APG5 APG5-LIKE APG5L ASP hAPG5
UniProtKB ID: Q9H1Y0, O60875, Q5JVR2, Q68DI4, Q9H2B8, Q9HCZ7
Gene ID:
Mouse(11793) autophagy related 5
Rat(365601) autophagy related 5
Zebrafish(494180) ATG5 autophagy related 5 homolog (S. cerevisiae)
chicken(421784) autophagy related 5
fruit fly(31666) Autophagy-specific gene 5
cow(532686) ATG5 autophagy related 5 homolog (S. cerevisiae)
domestic cat(101092114) autophagy related 5
dog(610868) autophagy related 5
sheep(100913169) autophagy related 5
naked mole-rat(101707624) autophagy related 5
domestic guinea pig(100735170) autophagy related 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305642 ANTI-APG5 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1105063 Anti-ATG5 (136-150) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105062 Anti-ATG5 (21-35) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
A0731 Anti-ATG5 (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody mouse, human
immunocytochemistry, western blot pricing
A0856 Anti-ATG5 (N-terminal) antibody produced in rabbit affinity isolated antibody, PBS solution human, rat, mouse
immunofluorescence, western blot pricing
GW22210F Anti-ATG5 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human
western blot pricing
SAB3500448 Anti-ATG5 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB2108076 Anti-ATG5 antibody produced in rabbit affinity isolated antibody rat, bovine, rabbit, guinea pig, mouse, horse, human
immunohistochemistry, western blot pricing
AV54267 Anti-ATG5 antibody produced in rabbit affinity isolated antibody, lyophilized powder human, bovine, mouse, rat, rabbit, horse
western blot pricing
HPA042973 Anti-ATG5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
WH0009474M1 Monoclonal Anti-ATG5 antibody produced in mouse clone 3D2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
A2859 Monoclonal Anti-ATG5 antibody produced in mouse clone ATG5-18, purified immunoglobulin, buffered aqueous solution rat, mouse, human
immunoprecipitation, western blot pricing
SAB1404726 Monoclonal Anti-ATG5, (C-terminal) antibody produced in mouse clone 1C4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004849 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004849 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004849 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053069 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053069 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053069 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004849 Rosetta Predictions human pricing
NM_001014250 Rosetta Predictions rat pricing
NM_053069 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173156 predicted 541
2 SASI_Hs02_00338435 predicted 546
3 SASI_Hs01_00173157 predicted 591
4 SASI_Hs01_00173158 predicted 1181
5 SASI_Hs01_00173159 predicted 1198
6 SASI_Hs01_00173160 predicted 576
7 SASI_Hs01_00173163 predicted 1188
8 SASI_Hs01_00173164 predicted 700
9 SASI_Hs01_00173165 predicted 1114
10 SASI_Hs02_00338436 predicted 1175
11 SASI_Hs01_00173161 predicted 529
12 SASI_Hs01_00173162 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094887 predicted 594
2 SASI_Rn01_00094888 predicted 757
3 SASI_Rn01_00094889 predicted 610
4 SASI_Rn01_00094890 predicted 720
5 SASI_Rn01_00094891 predicted 454
6 SASI_Rn01_00094892 predicted 521
7 SASI_Rn02_00201813 predicted 422
8 SASI_Rn01_00094893 predicted 275
9 SASI_Rn01_00094894 predicted 583
10 SASI_Rn01_00094895 predicted 459
11 SASI_Rn01_00094896 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089196 predicted 779
2 SASI_Mm01_00089197 predicted 332
3 SASI_Mm02_00337521 predicted 463
4 SASI_Mm01_00089199 predicted 617
5 SASI_Mm01_00089200 predicted 321
6 SASI_Mm01_00089201 predicted 583
7 SASI_Mm01_00089202 predicted 521
8 SASI_Mm01_00089203 predicted 1058
9 SASI_Mm01_00089205 predicted 663
10 SASI_Mm02_00337522 predicted 570
11 SASI_Mm01_00089198 predicted 497
12 SASI_Mm01_00089204 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004849
VALIDATED
ATG5 MISSION shRNA Bacterial Glycerol Stock
autophagy related 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000151963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004849.1-1170s1c1
Sequence:CCGGCCTGAACAGAATCATCCTTAACTCGAGTTAAGGATGATTCTGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004849.1-915s1c1
Sequence:CCGGCCTTTCATTCAGAAGCTGTTTCTCGAGAAACAGCTTCTGAATGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004849.1-420s1c1
Sequence:CCGGGCAGAACCATACTATTTGCTTCTCGAGAAGCAAATAGTATGGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004849.1-2567s1c1
Sequence:CCGGCCAGATATTCTGGAATGGAAACTCGAGTTTCCATTCCAGAATATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004849.1-1043s1c1
Sequence:CCGGGATTCATGGAATTGAGCCAATCTCGAGATTGGCTCAATTCCATGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004849.2-1070s21c1
Sequence:CCGGGATTCATGGAATTGAGCCAATCTCGAGATTGGCTCAATTCCATGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004849.2-942s21c1
Sequence:CCGGCCTTTCATTCAGAAGCTGTTTCTCGAGAAACAGCTTCTGAATGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004849.2-1175s21c1
Sequence:CCGGAGATTGAAGGATCAACTATTTCTCGAGAAATAGTTGATCCTTCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004849.2-1197s21c1
Sequence:CCGGCCTGAACAGAATCATCCTTAACTCGAGTTAAGGATGATTCTGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004849
VALIDATED
ATG5 MISSION shRNA shRNA Plasmid DNA
autophagy related 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000151963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004849.1-1170s1c1
Sequence:CCGGCCTGAACAGAATCATCCTTAACTCGAGTTAAGGATGATTCTGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004849.1-915s1c1
Sequence:CCGGCCTTTCATTCAGAAGCTGTTTCTCGAGAAACAGCTTCTGAATGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004849.1-420s1c1
Sequence:CCGGGCAGAACCATACTATTTGCTTCTCGAGAAGCAAATAGTATGGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004849.1-2567s1c1
Sequence:CCGGCCAGATATTCTGGAATGGAAACTCGAGTTTCCATTCCAGAATATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004849.1-1043s1c1
Sequence:CCGGGATTCATGGAATTGAGCCAATCTCGAGATTGGCTCAATTCCATGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004849.2-1070s21c1
Sequence:CCGGGATTCATGGAATTGAGCCAATCTCGAGATTGGCTCAATTCCATGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004849.2-942s21c1
Sequence:CCGGCCTTTCATTCAGAAGCTGTTTCTCGAGAAACAGCTTCTGAATGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004849.2-1175s21c1
Sequence:CCGGAGATTGAAGGATCAACTATTTCTCGAGAAATAGTTGATCCTTCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004849.2-1197s21c1
Sequence:CCGGCCTGAACAGAATCATCCTTAACTCGAGTTAAGGATGATTCTGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004849
VALIDATED
ATG5 MISSION shRNA Lentiviral Transduction Particles
autophagy related 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000151963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004849.1-1170s1c1
Sequence:CCGGCCTGAACAGAATCATCCTTAACTCGAGTTAAGGATGATTCTGTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004849.1-915s1c1
Sequence:CCGGCCTTTCATTCAGAAGCTGTTTCTCGAGAAACAGCTTCTGAATGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004849.1-420s1c1
Sequence:CCGGGCAGAACCATACTATTTGCTTCTCGAGAAGCAAATAGTATGGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004849.1-2567s1c1
Sequence:CCGGCCAGATATTCTGGAATGGAAACTCGAGTTTCCATTCCAGAATATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004849.1-1043s1c1
Sequence:CCGGGATTCATGGAATTGAGCCAATCTCGAGATTGGCTCAATTCCATGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004849.2-1070s21c1
Sequence:CCGGGATTCATGGAATTGAGCCAATCTCGAGATTGGCTCAATTCCATGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004849.2-942s21c1
Sequence:CCGGCCTTTCATTCAGAAGCTGTTTCTCGAGAAACAGCTTCTGAATGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004849.2-1175s21c1
Sequence:CCGGAGATTGAAGGATCAACTATTTCTCGAGAAATAGTTGATCCTTCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004849.2-1197s21c1
Sequence:CCGGCCTGAACAGAATCATCCTTAACTCGAGTTAAGGATGATTCTGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053069
VALIDATED
ATG5 MISSION shRNA Bacterial Glycerol Stock
autophagy related 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053069.2-1947s1c1
Sequence:CCGGGCCAAGTATCTGTCTATGATACTCGAGTATCATAGACAGATACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053069.2-576s1c1
Sequence:CCGGCCTTGGAACATCACAGTACATCTCGAGATGTACTGTGATGTTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053069.2-514s1c1
Sequence:CCGGCCCTGAAATGGCATTATCCAACTCGAGTTGGATAATGCCATTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053069.2-381s1c1
Sequence:CCGGGCAGAACCATACTATTTGCTTCTCGAGAAGCAAATAGTATGGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053069.5-1343s21c1
Sequence:CCGGAGCCGAAGCCTTTGCTCAATGCTCGAGCATTGAGCAAAGGCTTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053069.5-512s21c1
Sequence:CCGGCCCTGAAATGGCATTATCCAACTCGAGTTGGATAATGCCATTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053069.5-574s21c1
Sequence:CCGGCCTTGGAACATCACAGTACATCTCGAGATGTACTGTGATGTTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053069.5-1053s21c1
Sequence:CCGGGCATCTGAGCTACCCAGATAACTCGAGTTATCTGGGTAGCTCAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053069.5-379s21c1
Sequence:CCGGGCAGAACCATACTATTTGCTTCTCGAGAAGCAAATAGTATGGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053069.5-1315s21c1
Sequence:CCGGAGCCTCCTCTTCTCGTGAAATCTCGAGATTTCACGAGAAGAGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053069
VALIDATED
ATG5 MISSION shRNA shRNA Plasmid DNA
autophagy related 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053069.2-1947s1c1
Sequence:CCGGGCCAAGTATCTGTCTATGATACTCGAGTATCATAGACAGATACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053069.2-576s1c1
Sequence:CCGGCCTTGGAACATCACAGTACATCTCGAGATGTACTGTGATGTTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053069.2-514s1c1
Sequence:CCGGCCCTGAAATGGCATTATCCAACTCGAGTTGGATAATGCCATTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053069.2-381s1c1
Sequence:CCGGGCAGAACCATACTATTTGCTTCTCGAGAAGCAAATAGTATGGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053069.5-1343s21c1
Sequence:CCGGAGCCGAAGCCTTTGCTCAATGCTCGAGCATTGAGCAAAGGCTTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053069.5-512s21c1
Sequence:CCGGCCCTGAAATGGCATTATCCAACTCGAGTTGGATAATGCCATTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053069.5-574s21c1
Sequence:CCGGCCTTGGAACATCACAGTACATCTCGAGATGTACTGTGATGTTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053069.5-1053s21c1
Sequence:CCGGGCATCTGAGCTACCCAGATAACTCGAGTTATCTGGGTAGCTCAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053069.5-379s21c1
Sequence:CCGGGCAGAACCATACTATTTGCTTCTCGAGAAGCAAATAGTATGGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053069.5-1315s21c1
Sequence:CCGGAGCCTCCTCTTCTCGTGAAATCTCGAGATTTCACGAGAAGAGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053069
VALIDATED
ATG5 MISSION shRNA Lentiviral Transduction Particles
autophagy related 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053069.2-1947s1c1
Sequence:CCGGGCCAAGTATCTGTCTATGATACTCGAGTATCATAGACAGATACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053069.2-576s1c1
Sequence:CCGGCCTTGGAACATCACAGTACATCTCGAGATGTACTGTGATGTTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053069.2-514s1c1
Sequence:CCGGCCCTGAAATGGCATTATCCAACTCGAGTTGGATAATGCCATTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053069.2-381s1c1
Sequence:CCGGGCAGAACCATACTATTTGCTTCTCGAGAAGCAAATAGTATGGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053069.5-1343s21c1
Sequence:CCGGAGCCGAAGCCTTTGCTCAATGCTCGAGCATTGAGCAAAGGCTTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053069.5-512s21c1
Sequence:CCGGCCCTGAAATGGCATTATCCAACTCGAGTTGGATAATGCCATTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053069.5-574s21c1
Sequence:CCGGCCTTGGAACATCACAGTACATCTCGAGATGTACTGTGATGTTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053069.5-1053s21c1
Sequence:CCGGGCATCTGAGCTACCCAGATAACTCGAGTTATCTGGGTAGCTCAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053069.5-379s21c1
Sequence:CCGGGCAGAACCATACTATTTGCTTCTCGAGAAGCAAATAGTATGGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053069.5-1315s21c1
Sequence:CCGGAGCCTCCTCTTCTCGTGAAATCTCGAGATTTCACGAGAAGAGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)