EMAIL THIS PAGE TO A FRIEND

ATG7

autophagy related 7

66 Gene Product Result for
Synonyms: APG7-LIKE APG7L GSA7
UniProtKB ID: O95352, B4E170, E9PB95, Q7L8L0, Q9BWP2, Q9UFH4
Gene ID:
Human(10533) Summary: This gene was identified based on homology to Pichia pastoris GSA7 and Saccharomyces cerevisiae APG7. In the yeast, the protein appears to be required for fusion of peroxisomal and vacuolar membranes. The protein shows homology to the ATP-binding and catalytic sites of the E1 ubiquitin activating enzymes. [provided by RefSeq, Jan 2009]
Mouse(74244) autophagy related 7
Rat(312647) autophagy related 7
Zebrafish(100333016) ATG7 autophagy related 7 homolog (S. cerevisiae)
domestic cat(101093088) autophagy related 7
cow(787967) autophagy related 7
Horse(100051544) autophagy related 7
dog(476533) autophagy related 7
fruit fly(37141) Autophagy-specific gene 7
chicken(415961) autophagy related 7
domestic guinea pig(100730244) autophagy related 7
naked mole-rat(101714077) autophagy related 7
sheep(101121977) autophagy related 7
Domestic Rabbit(100342374) autophagy related 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006395 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006395 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006395 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028835 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028835 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028835 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006395 Rosetta Predictions human pricing
NM_001012097 Rosetta Predictions rat pricing
XM_575646 Rosetta Predictions rat pricing
NM_028835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077648 predicted 353
2 SASI_Hs01_00077649 predicted 262
3 SASI_Hs02_00341471 predicted 1975
4 SASI_Hs01_00077650 predicted 1349
5 SASI_Hs01_00077652 predicted 1653
6 SASI_Hs01_00077653 predicted 705
7 SASI_Hs02_00341472 predicted 696
8 SASI_Hs01_00077654 predicted 1787
9 SASI_Hs01_00077655 predicted 553
10 SASI_Hs01_00077656 predicted 2005
11 SASI_Hs01_00077651 predicted 1532
12 SASI_Hs01_00077657 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050326 predicted 844
2 SASI_Rn01_00050327 predicted 1192
3 SASI_Rn01_00050328 predicted 1940
4 SASI_Rn01_00050329 predicted 660
5 SASI_Rn01_00050330 predicted 1624
6 SASI_Rn01_00050333 predicted 689
7 SASI_Rn01_00050334 predicted 1143
8 SASI_Rn01_00050335 predicted 1323
9 SASI_Rn02_00200231 predicted 1504
10 SASI_Rn02_00200232 predicted 850
11 SASI_Rn01_00050331 predicted 1949
12 SASI_Rn01_00050332 predicted 1824
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575646 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135252 predicted 1215
2 SASI_Rn01_00135253 predicted 1571
3 SASI_Rn01_00135254 predicted 2309
4 SASI_Rn01_00135255 predicted 1031
5 SASI_Rn01_00135256 predicted 2004
6 SASI_Rn01_00135257 predicted 2321
7 SASI_Rn01_00135258 predicted 2191
8 SASI_Rn01_00135259 predicted 1063
9 SASI_Rn01_00135260 predicted 1522
10 SASI_Rn01_00135261 predicted 1693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044616 predicted 1364
2 SASI_Mm01_00044617 predicted 804
3 SASI_Mm01_00044618 predicted 872
4 SASI_Mm01_00044619 predicted 2070
5 SASI_Mm01_00044620 predicted 1974
6 SASI_Mm01_00044621 predicted 1667
7 SASI_Mm01_00044622 predicted 1545
8 SASI_Mm01_00044623 predicted 1015
9 SASI_Mm01_00044624 predicted 1172
10 SASI_Mm01_00044625 predicted 921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006395
VALIDATED
ATG7 MISSION shRNA Bacterial Glycerol Stock
autophagy related 7
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006395.2-2415s21c1
Sequence:CCGGCACCAGTTCAGAGCTAAATAACTCGAGTTATTTAGCTCTGAACTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006395.2-2068s21c1
Sequence:CCGGTCCAAAGTTCTTGATCAATATCTCGAGATATTGATCAAGAACTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006395.2-516s21c1
Sequence:CCGGCTTGACATTTGCAGATCTAAACTCGAGTTTAGATCTGCAAATGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006395.2-249s21c1
Sequence:CCGGCAAGGACATTAAGGGTTATTACTCGAGTAATAACCCTTAATGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006395.2-1104s21c1
Sequence:CCGGTGAGTCATCAGTGGATCTAAACTCGAGTTTAGATCCACTGATGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006395.2-1249s21c1
Sequence:CCGGGGCGTGAGACACATCACATTTCTCGAGAAATGTGATGTGTCTCACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006395.1-2173s1c1
Sequence:CCGGGCCTGCTGAGGAGCTCTCCATCTCGAGATGGAGAGCTCCTCAGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006395.1-1520s1c1
Sequence:CCGGGCTTTGGGATTTGACACATTTCTCGAGAAATGTGTCAAATCCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006395.1-685s1c1
Sequence:CCGGCCAAGGTCAAAGGACGAAGATCTCGAGATCTTCGTCCTTTGACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006395.1-268s1c1
Sequence:CCGGCCCAGCTATTGGAACACTGTACTCGAGTACAGTGTTCCAATAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006395.1-491s1c1
Sequence:CCGGCCAGAGAGTTTACCTCTCATTCTCGAGAATGAGAGGTAAACTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006395
VALIDATED
ATG7 MISSION shRNA shRNA Plasmid DNA
autophagy related 7
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006395.2-2415s21c1
Sequence:CCGGCACCAGTTCAGAGCTAAATAACTCGAGTTATTTAGCTCTGAACTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006395.2-2068s21c1
Sequence:CCGGTCCAAAGTTCTTGATCAATATCTCGAGATATTGATCAAGAACTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006395.2-516s21c1
Sequence:CCGGCTTGACATTTGCAGATCTAAACTCGAGTTTAGATCTGCAAATGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006395.2-249s21c1
Sequence:CCGGCAAGGACATTAAGGGTTATTACTCGAGTAATAACCCTTAATGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006395.2-1104s21c1
Sequence:CCGGTGAGTCATCAGTGGATCTAAACTCGAGTTTAGATCCACTGATGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006395.2-1249s21c1
Sequence:CCGGGGCGTGAGACACATCACATTTCTCGAGAAATGTGATGTGTCTCACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006395.1-2173s1c1
Sequence:CCGGGCCTGCTGAGGAGCTCTCCATCTCGAGATGGAGAGCTCCTCAGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006395.1-1520s1c1
Sequence:CCGGGCTTTGGGATTTGACACATTTCTCGAGAAATGTGTCAAATCCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006395.1-685s1c1
Sequence:CCGGCCAAGGTCAAAGGACGAAGATCTCGAGATCTTCGTCCTTTGACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006395.1-268s1c1
Sequence:CCGGCCCAGCTATTGGAACACTGTACTCGAGTACAGTGTTCCAATAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006395.1-491s1c1
Sequence:CCGGCCAGAGAGTTTACCTCTCATTCTCGAGAATGAGAGGTAAACTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006395
VALIDATED
ATG7 MISSION shRNA Lentiviral Transduction Particles
autophagy related 7
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006395.2-2415s21c1
Sequence:CCGGCACCAGTTCAGAGCTAAATAACTCGAGTTATTTAGCTCTGAACTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006395.2-2068s21c1
Sequence:CCGGTCCAAAGTTCTTGATCAATATCTCGAGATATTGATCAAGAACTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006395.2-516s21c1
Sequence:CCGGCTTGACATTTGCAGATCTAAACTCGAGTTTAGATCTGCAAATGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006395.2-249s21c1
Sequence:CCGGCAAGGACATTAAGGGTTATTACTCGAGTAATAACCCTTAATGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006395.2-1104s21c1
Sequence:CCGGTGAGTCATCAGTGGATCTAAACTCGAGTTTAGATCCACTGATGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006395.2-1249s21c1
Sequence:CCGGGGCGTGAGACACATCACATTTCTCGAGAAATGTGATGTGTCTCACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006395.1-2173s1c1
Sequence:CCGGGCCTGCTGAGGAGCTCTCCATCTCGAGATGGAGAGCTCCTCAGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006395.1-1520s1c1
Sequence:CCGGGCTTTGGGATTTGACACATTTCTCGAGAAATGTGTCAAATCCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006395.1-685s1c1
Sequence:CCGGCCAAGGTCAAAGGACGAAGATCTCGAGATCTTCGTCCTTTGACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006395.1-268s1c1
Sequence:CCGGCCCAGCTATTGGAACACTGTACTCGAGTACAGTGTTCCAATAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006395.1-491s1c1
Sequence:CCGGCCAGAGAGTTTACCTCTCATTCTCGAGAATGAGAGGTAAACTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028835
VALIDATED
ATG7 MISSION shRNA Bacterial Glycerol Stock
autophagy related 7
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028835.3-2360s21c1
Sequence:CCGGGTCCTTCCATGTGCACTAATCCTCGAGGATTAGTGCACATGGAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028835.3-1854s21c1
Sequence:CCGGGCAGTGATGACCGCATGAATGCTCGAGCATTCATGCGGTCATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028835.3-1920s21c1
Sequence:CCGGTTCTGTCACGGTTCGATAATGCTCGAGCATTATCGAACCGTGACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028835.3-451s21c1
Sequence:CCGGCCTAAAGAAGTACCACTTCTACTCGAGTAGAAGTGGTACTTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028835.3-2077s21c1
Sequence:CCGGTCTTACCCTGCTCCATCAAGACTCGAGTCTTGATGGAGCAGGGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028835.3-1655s21c1
Sequence:CCGGGCCAACATCCCTGGATACAAGCTCGAGCTTGTATCCAGGGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028835.1-2309s1c1
Sequence:CCGGCCAGCTCTGAACTCAATAATACTCGAGTATTATTGAGTTCAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028835.1-1954s1c1
Sequence:CCGGGCCTGGCATTTGATAAATGTACTCGAGTACATTTATCAAATGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028835.1-452s1c1
Sequence:CCGGCCTAAAGAAGTACCACTTCTACTCGAGTAGAAGTGGTACTTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028835.1-698s1c1
Sequence:CCGGCCAAGGTCAAAGGACAAAGATCTCGAGATCTTTGTCCTTTGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028835.1-872s1c1
Sequence:CCGGCGTGACACATAGCATCATCTTCTCGAGAAGATGATGCTATGTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028835
VALIDATED
ATG7 MISSION shRNA shRNA Plasmid DNA
autophagy related 7
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028835.3-2360s21c1
Sequence:CCGGGTCCTTCCATGTGCACTAATCCTCGAGGATTAGTGCACATGGAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028835.3-1854s21c1
Sequence:CCGGGCAGTGATGACCGCATGAATGCTCGAGCATTCATGCGGTCATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028835.3-1920s21c1
Sequence:CCGGTTCTGTCACGGTTCGATAATGCTCGAGCATTATCGAACCGTGACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028835.3-451s21c1
Sequence:CCGGCCTAAAGAAGTACCACTTCTACTCGAGTAGAAGTGGTACTTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028835.3-2077s21c1
Sequence:CCGGTCTTACCCTGCTCCATCAAGACTCGAGTCTTGATGGAGCAGGGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028835.3-1655s21c1
Sequence:CCGGGCCAACATCCCTGGATACAAGCTCGAGCTTGTATCCAGGGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028835.1-2309s1c1
Sequence:CCGGCCAGCTCTGAACTCAATAATACTCGAGTATTATTGAGTTCAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028835.1-1954s1c1
Sequence:CCGGGCCTGGCATTTGATAAATGTACTCGAGTACATTTATCAAATGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028835.1-452s1c1
Sequence:CCGGCCTAAAGAAGTACCACTTCTACTCGAGTAGAAGTGGTACTTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028835.1-698s1c1
Sequence:CCGGCCAAGGTCAAAGGACAAAGATCTCGAGATCTTTGTCCTTTGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028835.1-872s1c1
Sequence:CCGGCGTGACACATAGCATCATCTTCTCGAGAAGATGATGCTATGTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028835
VALIDATED
ATG7 MISSION shRNA Lentiviral Transduction Particles
autophagy related 7
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028835.3-2360s21c1
Sequence:CCGGGTCCTTCCATGTGCACTAATCCTCGAGGATTAGTGCACATGGAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028835.3-1854s21c1
Sequence:CCGGGCAGTGATGACCGCATGAATGCTCGAGCATTCATGCGGTCATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028835.3-1920s21c1
Sequence:CCGGTTCTGTCACGGTTCGATAATGCTCGAGCATTATCGAACCGTGACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028835.3-451s21c1
Sequence:CCGGCCTAAAGAAGTACCACTTCTACTCGAGTAGAAGTGGTACTTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028835.3-2077s21c1
Sequence:CCGGTCTTACCCTGCTCCATCAAGACTCGAGTCTTGATGGAGCAGGGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028835.3-1655s21c1
Sequence:CCGGGCCAACATCCCTGGATACAAGCTCGAGCTTGTATCCAGGGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028835.1-2309s1c1
Sequence:CCGGCCAGCTCTGAACTCAATAATACTCGAGTATTATTGAGTTCAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028835.1-1954s1c1
Sequence:CCGGGCCTGGCATTTGATAAATGTACTCGAGTACATTTATCAAATGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028835.1-452s1c1
Sequence:CCGGCCTAAAGAAGTACCACTTCTACTCGAGTAGAAGTGGTACTTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028835.1-698s1c1
Sequence:CCGGCCAAGGTCAAAGGACAAAGATCTCGAGATCTTTGTCCTTTGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028835.1-872s1c1
Sequence:CCGGCGTGACACATAGCATCATCTTCTCGAGAAGATGATGCTATGTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks