EMAIL THIS PAGE TO A FRIEND

ATG9A

autophagy related 9A

184 Gene Product Result for
Synonyms: APG9L1 MGD3208 mATG9
Gene ID:
Mouse(245860) autophagy related 9A
Rat(363254) autophagy related 9A
Zebrafish(100009663) ATG9 autophagy related 9 homolog A (S. cerevisiae)
cow(540482) ATG9 autophagy related 9 homolog A (S. cerevisiae)
domestic cat(101094780) autophagy related 9A
dog(478915) ATG9 autophagy related 9 homolog A (S. cerevisiae)
dog(478914) autophagy related 9A
chicken(425722) autophagy related 9A
sheep(100913171) autophagy related 9A
Domestic Rabbit(100350996) autophagy related 9A
naked mole-rat(101720635) autophagy related 9A
domestic guinea pig(100722233) autophagy related 9A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003917 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003917 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003917 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024085 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024085 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024085 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077198 Rosetta Predictions human pricing
NM_024085 Rosetta Predictions human pricing
NM_001014218 Rosetta Predictions rat pricing
NM_001003917 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312184 predicted 1852
2 SASI_Hs02_00312185 predicted 616
3 SASI_Hs02_00312186 predicted 459
4 SASI_Hs02_00312187 predicted 1587
5 SASI_Hs02_00312188 predicted 1362
6 SASI_Hs02_00312189 predicted 628
7 SASI_Hs02_00312190 predicted 772
8 SASI_Hs02_00312191 predicted 1100
9 SASI_Hs02_00312192 predicted 579
10 SASI_Hs02_00312193 predicted 2545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176061 predicted 1795
2 SASI_Hs01_00176062 predicted 565
3 SASI_Hs01_00176064 predicted 411
4 SASI_Hs01_00176065 predicted 1536
5 SASI_Hs02_00356553 predicted 1308
6 SASI_Hs01_00176066 predicted 573
7 SASI_Hs02_00356554 predicted 726
8 SASI_Hs01_00176068 predicted 1044
9 SASI_Hs01_00176069 predicted 524
10 SASI_Hs02_00356555 predicted 2485
11 SASI_Hs01_00176060 predicted 272
12 SASI_Hs01_00176063 predicted 1177
13 SASI_Hs01_00176067 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014218 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041804 predicted 538
2 SASI_Rn01_00041805 predicted 1597
3 SASI_Rn01_00041806 predicted 2616
4 SASI_Rn01_00041807 predicted 699
5 SASI_Rn01_00041808 predicted 3022
6 SASI_Rn01_00041809 predicted 2186
7 SASI_Rn01_00041810 predicted 1343
8 SASI_Rn01_00041811 predicted 687
9 SASI_Rn01_00041812 predicted 1715
10 SASI_Rn01_00041813 predicted 2624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132192 predicted 725
2 SASI_Mm01_00132194 predicted 1106
3 SASI_Mm01_00132195 predicted 355
4 SASI_Mm01_00132196 predicted 1184
5 SASI_Mm01_00132197 predicted 1178
6 SASI_Mm01_00132198 predicted 619
7 SASI_Mm01_00132199 predicted 1260
8 SASI_Mm01_00132201 predicted 735
9 SASI_Mm02_00286360 predicted 1811
10 SASI_Mm02_00286361 predicted 1362
11 SASI_Mm01_00132193 predicted 622
12 SASI_Mm01_00132200 predicted 1773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003917
ATG9A MISSION shRNA Bacterial Glycerol Stock
autophagy related 9A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000195926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003917.1-1533s1c1
Sequence:CCGGCCGAGTGATTCTTGCACACATCTCGAGATGTGTGCAAGAATCACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184741    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003917.1-3506s1c1
Sequence:CCGGCCTCACTTACCAAGAGGAGAACTCGAGTTCTCCTCTTGGTAAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003917.1-651s1c1
Sequence:CCGGCCACCGGCTTATCAAGTTTATCTCGAGATAAACTTGATAAGCCGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003917.1-2848s1c1
Sequence:CCGGCCAGGAAGAATATGAGGACTACTCGAGTAGTCCTCATATTCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003917
ATG9A MISSION shRNA shRNA Plasmid DNA
autophagy related 9A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000195926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003917.1-1533s1c1
Sequence:CCGGCCGAGTGATTCTTGCACACATCTCGAGATGTGTGCAAGAATCACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184741    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003917.1-3506s1c1
Sequence:CCGGCCTCACTTACCAAGAGGAGAACTCGAGTTCTCCTCTTGGTAAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003917.1-651s1c1
Sequence:CCGGCCACCGGCTTATCAAGTTTATCTCGAGATAAACTTGATAAGCCGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003917.1-2848s1c1
Sequence:CCGGCCAGGAAGAATATGAGGACTACTCGAGTAGTCCTCATATTCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003917
ATG9A MISSION shRNA Lentiviral Transduction Particles
autophagy related 9A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000195926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003917.1-1533s1c1
Sequence:CCGGCCGAGTGATTCTTGCACACATCTCGAGATGTGTGCAAGAATCACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184741    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003917.1-3506s1c1
Sequence:CCGGCCTCACTTACCAAGAGGAGAACTCGAGTTCTCCTCTTGGTAAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003917.1-651s1c1
Sequence:CCGGCCACCGGCTTATCAAGTTTATCTCGAGATAAACTTGATAAGCCGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003917.1-2848s1c1
Sequence:CCGGCCAGGAAGAATATGAGGACTACTCGAGTAGTCCTCATATTCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024085
VALIDATED
ATG9A MISSION shRNA Bacterial Glycerol Stock
autophagy related 9A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024085.2-1921s1c1
Sequence:CCGGCGTCTATCCAGTCCTTACAATCTCGAGATTGTAAGGACTGGATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024085.2-1916s1c1
Sequence:CCGGCTTTACGTCTATCCAGTCCTTCTCGAGAAGGACTGGATAGACGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024085.2-1508s1c1
Sequence:CCGGCTTCCAGTACAAGGCAGTGTTCTCGAGAACACTGCCTTGTACTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024085.3-1388s21c1
Sequence:CCGGGACCGTGTGCAGGTCCTTTATCTCGAGATAAAGGACCTGCACACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024085.3-235s21c1
Sequence:CCGGAGTCACCTTGGCACCATATTGCTCGAGCAATATGGTGCCAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024085.3-393s21c1
Sequence:CCGGGTGGACTATGACATCCTATTTCTCGAGAAATAGGATGTCATAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024085.3-2253s21c1
Sequence:CCGGAGCCTGCATGCCCTCTATATGCTCGAGCATATAGAGGGCATGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024085.3-3318s21c1
Sequence:CCGGTGTAGGAGCAGGATGGAAATACTCGAGTATTTCCATCCTGCTCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024085
VALIDATED
ATG9A MISSION shRNA shRNA Plasmid DNA
autophagy related 9A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024085.2-1921s1c1
Sequence:CCGGCGTCTATCCAGTCCTTACAATCTCGAGATTGTAAGGACTGGATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024085.2-1916s1c1
Sequence:CCGGCTTTACGTCTATCCAGTCCTTCTCGAGAAGGACTGGATAGACGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024085.2-1508s1c1
Sequence:CCGGCTTCCAGTACAAGGCAGTGTTCTCGAGAACACTGCCTTGTACTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024085.3-1388s21c1
Sequence:CCGGGACCGTGTGCAGGTCCTTTATCTCGAGATAAAGGACCTGCACACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024085.3-235s21c1
Sequence:CCGGAGTCACCTTGGCACCATATTGCTCGAGCAATATGGTGCCAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024085.3-393s21c1
Sequence:CCGGGTGGACTATGACATCCTATTTCTCGAGAAATAGGATGTCATAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024085.3-2253s21c1
Sequence:CCGGAGCCTGCATGCCCTCTATATGCTCGAGCATATAGAGGGCATGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024085.3-3318s21c1
Sequence:CCGGTGTAGGAGCAGGATGGAAATACTCGAGTATTTCCATCCTGCTCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024085
VALIDATED
ATG9A MISSION shRNA Lentiviral Transduction Particles
autophagy related 9A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024085.2-1921s1c1
Sequence:CCGGCGTCTATCCAGTCCTTACAATCTCGAGATTGTAAGGACTGGATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024085.2-1916s1c1
Sequence:CCGGCTTTACGTCTATCCAGTCCTTCTCGAGAAGGACTGGATAGACGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024085.2-1508s1c1
Sequence:CCGGCTTCCAGTACAAGGCAGTGTTCTCGAGAACACTGCCTTGTACTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024085.3-1388s21c1
Sequence:CCGGGACCGTGTGCAGGTCCTTTATCTCGAGATAAAGGACCTGCACACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024085.3-235s21c1
Sequence:CCGGAGTCACCTTGGCACCATATTGCTCGAGCAATATGGTGCCAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024085.3-393s21c1
Sequence:CCGGGTGGACTATGACATCCTATTTCTCGAGAAATAGGATGTCATAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024085.3-2253s21c1
Sequence:CCGGAGCCTGCATGCCCTCTATATGCTCGAGCATATAGAGGGCATGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024085.3-3318s21c1
Sequence:CCGGTGTAGGAGCAGGATGGAAATACTCGAGTATTTCCATCCTGCTCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks