EMAIL THIS PAGE TO A FRIEND

ATG9B

autophagy related 9B

118 Gene Product Result for
Synonyms: APG9L2 NOS3AS SONE
UniProtKB ID: Q674R7, A1A5D3, Q6JRW5, Q8N8I8
Gene ID:
Human(285973) Summary: This gene functions in the regulation of autophagy, a lysosomal degradation pathway. This gene also functions as an antisense transcript in the posttranscriptional regulation of the endothelial nitric oxide synthase 3 gene, which has 3' overlap with this gene on the opposite strand. Mutations in this gene and disruption of the autophagy process have been associated with multiple cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
Mouse(213948) autophagy related 9B
Rat(499973) autophagy related 9B
domestic guinea pig(100712826) autophagy related 9B
naked mole-rat(101710743) autophagy related 9B
sheep(101112811) autophagy related 9B
Domestic Rabbit(100350757) autophagy related 9B
Zebrafish(791223) ATG9 autophagy related 9 homolog B (S. cerevisiae)
domestic cat(101096716) autophagy related 9B
cow(506862) autophagy related 9B
Horse(100064027) autophagy related 9B
dog(482799) autophagy related 9B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304005 ANTI-ATG9B (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2900877 Anti-ATG9B / APG9L2 antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB3500501 Anti-ATG9B antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
SAB2107350 Anti-ATG9B antibody produced in rabbit affinity isolated antibody horse, guinea pig, human, rabbit
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001002897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001002897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173681 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173681 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173681 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU061211 MISSION® esiRNA esiRNA targeting mouse Atg9b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173681 Rosetta Predictions human pricing
XM_001061181 Rosetta Predictions rat pricing
XM_575327 Rosetta Predictions rat pricing
NM_001002897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130411 predicted 764
2 SASI_Hs02_00368624 predicted 1146
3 SASI_Hs02_00368625 predicted 715
4 SASI_Hs01_00130416 predicted 951
5 SASI_Hs01_00130417 predicted 985
6 SASI_Hs01_00130418 predicted 686
7 SASI_Hs01_00130419 predicted 2754
8 SASI_Hs02_00368626 predicted 683
9 SASI_Hs01_00130420 predicted 2135
10 SASI_Hs02_00368627 predicted 2543
11 SASI_Hs01_00130412 predicted 3317
12 SASI_Hs01_00130413 predicted 788
13 SASI_Hs01_00130414 predicted 2695
14 SASI_Hs01_00130415 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299026 predicted 2922
2 SASI_Rn02_00299027 predicted 2053
3 SASI_Rn02_00299028 predicted 1000
4 SASI_Rn02_00299029 predicted 2737
5 SASI_Rn02_00299030 predicted 2731
6 SASI_Rn02_00299031 predicted 3028
7 SASI_Rn02_00299032 predicted 1598
8 SASI_Rn02_00299033 predicted 1055
9 SASI_Rn02_00299034 predicted 2388
10 SASI_Rn02_00299035 predicted 3019
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403488 predicted 3224
2 SASI_Rn02_00403489 predicted 3471
3 SASI_Rn02_00403490 predicted 3226
4 SASI_Rn02_00403491 predicted 3474
5 SASI_Rn02_00403492 predicted 3482
6 SASI_Rn02_00403493 predicted 3212
7 SASI_Rn02_00403494 predicted 3269
8 SASI_Rn02_00403495 predicted 3473
9 SASI_Rn02_00403496 predicted 645
10 SASI_Rn02_00403497 predicted 2918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160098 predicted 821
2 SASI_Mm01_00160099 predicted 1000
3 SASI_Mm01_00160100 predicted 1308
4 SASI_Mm01_00160101 predicted 2733
5 SASI_Mm01_00160102 predicted 2708
6 SASI_Mm01_00160103 predicted 3024
7 SASI_Mm01_00160104 predicted 2393
8 SASI_Mm01_00160105 predicted 1598
9 SASI_Mm01_00160106 predicted 3094
10 SASI_Mm01_00160107 predicted 975
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002897
ATG9B MISSION shRNA Bacterial Glycerol Stock
autophagy related 9B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002897.3-922s21c1
Sequence:CCGGTTCGCTGCGTGGATTACAATGCTCGAGCATTGTAATCCACGCAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002897.3-2529s21c1
Sequence:CCGGCTTGCCAACCTCTTGGTAAATCTCGAGATTTACCAAGAGGTTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002897.3-2609s21c1
Sequence:CCGGCAGCCTCCTTGCCTCTATTTCCTCGAGGAAATAGAGGCAAGGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002897.3-2717s21c1
Sequence:CCGGGATGAGCCTCCACGCTATTTACTCGAGTAAATAGCGTGGAGGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002897.3-3123s21c1
Sequence:CCGGGGCCATATCTGGGAGTCAAAGCTCGAGCTTTGACTCCCAGATATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002897.2-2339s1c1
Sequence:CCGGCGAACTCTCCTTAATGCGGTTCTCGAGAACCGCATTAAGGAGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002897.2-3307s1c1
Sequence:CCGGGCATGGTTCAACTCAGTGTTACTCGAGTAACACTGAGTTGAACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002897
ATG9B MISSION shRNA shRNA Plasmid DNA
autophagy related 9B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002897.3-922s21c1
Sequence:CCGGTTCGCTGCGTGGATTACAATGCTCGAGCATTGTAATCCACGCAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002897.3-2529s21c1
Sequence:CCGGCTTGCCAACCTCTTGGTAAATCTCGAGATTTACCAAGAGGTTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002897.3-2609s21c1
Sequence:CCGGCAGCCTCCTTGCCTCTATTTCCTCGAGGAAATAGAGGCAAGGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002897.3-2717s21c1
Sequence:CCGGGATGAGCCTCCACGCTATTTACTCGAGTAAATAGCGTGGAGGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002897.3-3123s21c1
Sequence:CCGGGGCCATATCTGGGAGTCAAAGCTCGAGCTTTGACTCCCAGATATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002897.2-2339s1c1
Sequence:CCGGCGAACTCTCCTTAATGCGGTTCTCGAGAACCGCATTAAGGAGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002897.2-3307s1c1
Sequence:CCGGGCATGGTTCAACTCAGTGTTACTCGAGTAACACTGAGTTGAACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002897
ATG9B MISSION shRNA Lentiviral Transduction Particles
autophagy related 9B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002897.3-922s21c1
Sequence:CCGGTTCGCTGCGTGGATTACAATGCTCGAGCATTGTAATCCACGCAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002897.3-2529s21c1
Sequence:CCGGCTTGCCAACCTCTTGGTAAATCTCGAGATTTACCAAGAGGTTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002897.3-2609s21c1
Sequence:CCGGCAGCCTCCTTGCCTCTATTTCCTCGAGGAAATAGAGGCAAGGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002897.3-2717s21c1
Sequence:CCGGGATGAGCCTCCACGCTATTTACTCGAGTAAATAGCGTGGAGGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002897.3-3123s21c1
Sequence:CCGGGGCCATATCTGGGAGTCAAAGCTCGAGCTTTGACTCCCAGATATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002897.2-2339s1c1
Sequence:CCGGCGAACTCTCCTTAATGCGGTTCTCGAGAACCGCATTAAGGAGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002897.2-3307s1c1
Sequence:CCGGGCATGGTTCAACTCAGTGTTACTCGAGTAACACTGAGTTGAACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173681
ATG9B MISSION shRNA Bacterial Glycerol Stock
autophagy related 9B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173681.2-812s1c1
Sequence:CCGGCCAAGTAACCATACCAGACCTCTCGAGAGGTCTGGTATGGTTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158898    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173681.2-3950s1c1
Sequence:CCGGGCTCAATATGAACACCTTGTACTCGAGTACAAGGTGTTCATATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159604    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173681.2-4031s1c1
Sequence:CCGGGCAGTTCTTCTTTGAGTCTTACTCGAGTAAGACTCAAAGAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173681.2-2089s1c1
Sequence:CCGGCTTTGCCCTTATGGATGTGAACTCGAGTTCACATCCATAAGGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173681.2-640s1c1
Sequence:CCGGCATCCAGAACCTGGACAGTTTCTCGAGAAACTGTCCAGGTTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173681.2-2276s1c1
Sequence:CCGGCGAGTACAACAAGATGCAGCTCTCGAGAGCTGCATCTTGTTGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173681.2-722s1c1
Sequence:CCGGGTCTTCCAGCTGGGACAATTTCTCGAGAAATTGTCCCAGCTGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173681
ATG9B MISSION shRNA shRNA Plasmid DNA
autophagy related 9B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173681.2-812s1c1
Sequence:CCGGCCAAGTAACCATACCAGACCTCTCGAGAGGTCTGGTATGGTTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158898    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173681.2-3950s1c1
Sequence:CCGGGCTCAATATGAACACCTTGTACTCGAGTACAAGGTGTTCATATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159604    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173681.2-4031s1c1
Sequence:CCGGGCAGTTCTTCTTTGAGTCTTACTCGAGTAAGACTCAAAGAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173681.2-2089s1c1
Sequence:CCGGCTTTGCCCTTATGGATGTGAACTCGAGTTCACATCCATAAGGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173681.2-640s1c1
Sequence:CCGGCATCCAGAACCTGGACAGTTTCTCGAGAAACTGTCCAGGTTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173681.2-2276s1c1
Sequence:CCGGCGAGTACAACAAGATGCAGCTCTCGAGAGCTGCATCTTGTTGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173681.2-722s1c1
Sequence:CCGGGTCTTCCAGCTGGGACAATTTCTCGAGAAATTGTCCCAGCTGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173681
ATG9B MISSION shRNA Lentiviral Transduction Particles
autophagy related 9B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173681.2-812s1c1
Sequence:CCGGCCAAGTAACCATACCAGACCTCTCGAGAGGTCTGGTATGGTTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158898    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173681.2-3950s1c1
Sequence:CCGGGCTCAATATGAACACCTTGTACTCGAGTACAAGGTGTTCATATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159604    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173681.2-4031s1c1
Sequence:CCGGGCAGTTCTTCTTTGAGTCTTACTCGAGTAAGACTCAAAGAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173681.2-2089s1c1
Sequence:CCGGCTTTGCCCTTATGGATGTGAACTCGAGTTCACATCCATAAGGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173681.2-640s1c1
Sequence:CCGGCATCCAGAACCTGGACAGTTTCTCGAGAAACTGTCCAGGTTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173681.2-2276s1c1
Sequence:CCGGCGAGTACAACAAGATGCAGCTCTCGAGAGCTGCATCTTGTTGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173681.2-722s1c1
Sequence:CCGGGTCTTCCAGCTGGGACAATTTCTCGAGAAATTGTCCCAGCTGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks