EMAIL THIS PAGE TO A FRIEND

ATHL1

ATH1, acid trehalase-like 1 (yeast)

64 Gene Product Result for
UniProtKB ID: Q32M88, Q658X8, Q8TEG9, Q9H635
Gene ID:
Mouse(212974) ATH1, acid trehalase-like 1 (yeast)
Rat(309103) ATH1, acid trehalase-like 1 (yeast)
Zebrafish(777617) ATH1, acid trehalase-like 1 (yeast)
domestic cat(101087100) ATH1, acid trehalase-like 1 (yeast)
dog(483395) ATH1, acid trehalase-like 1 (yeast)
chicken(422991) ATH1, acid trehalase-like 1 (yeast)
naked mole-rat(101723837) ATH1, acid trehalase-like 1 (yeast)
domestic guinea pig(100719730) ATH1, acid trehalase-like 1 (yeast)
sheep(101106382) ATH1, acid trehalase-like 1 (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145387 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145387 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145387 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025092 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025092 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025092 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU042331 MISSION® esiRNA esiRNA targeting mouse Athl1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025092 Rosetta Predictions human pricing
XM_219475 Rosetta Predictions rat pricing
XR_007957 Rosetta Predictions rat pricing
NM_145387 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111895 predicted 1036
2 SASI_Hs01_00111897 predicted 1968
3 SASI_Hs01_00111899 predicted 1235
4 SASI_Hs01_00111900 predicted 1412
5 SASI_Hs01_00111901 predicted 2210
6 SASI_Hs02_00357791 predicted 690
7 SASI_Hs01_00111902 predicted 2400
8 SASI_Hs02_00357792 predicted 356
9 SASI_Hs01_00111903 predicted 1012
10 SASI_Hs02_00357793 predicted 2325
11 SASI_Hs01_00111894 predicted 2017
12 SASI_Hs01_00111896 predicted 1870
13 SASI_Hs01_00111898 predicted 1847
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219475 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125414 predicted 310
2 SASI_Rn01_00125415 predicted 1420
3 SASI_Rn01_00125416 predicted 1251
4 SASI_Rn01_00125417 predicted 888
5 SASI_Rn01_00125418 predicted 1299
6 SASI_Rn01_00125419 predicted 1200
7 SASI_Rn01_00125420 predicted 284
8 SASI_Rn01_00125421 predicted 1294
9 SASI_Rn01_00125422 predicted 1671
10 SASI_Rn01_00125423 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00415920 predicted 507
2 SASI_Rn02_00415921 predicted 635
3 SASI_Rn01_00146970 predicted 301
4 SASI_Rn02_00415922 predicted 337
5 SASI_Rn01_00146979 predicted 302
6 SASI_Rn02_00415923 predicted 589
7 SASI_Rn02_00415924 predicted 525
8 SASI_Rn02_00415925 predicted 329
9 SASI_Rn02_00415926 predicted 418
10 SASI_Rn02_00415927 predicted 513
11 SASI_Rn01_00146971 predicted 1420
12 SASI_Rn01_00146972 predicted 1245
13 SASI_Rn01_00146973 predicted 885
14 SASI_Rn01_00146974 predicted 1304
15 SASI_Rn01_00146975 predicted 1199
16 SASI_Rn01_00146976 predicted 290
17 SASI_Rn01_00146977 predicted 1294
18 SASI_Rn01_00146978 predicted 1666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128977 predicted 1946
2 SASI_Mm01_00128978 predicted 1397
3 SASI_Mm01_00128979 predicted 1783
4 SASI_Mm01_00128980 predicted 1678
5 SASI_Mm01_00128982 predicted 966
6 SASI_Mm01_00128983 predicted 1383
7 SASI_Mm01_00128984 predicted 945
8 SASI_Mm01_00128985 predicted 1284
9 SASI_Mm01_00128986 predicted 1333
10 SASI_Mm02_00340705 predicted 1653
11 SASI_Mm01_00128981 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145387
VALIDATED
ATHL1 MISSION shRNA Bacterial Glycerol Stock
ATH1, acid trehalase-like 1 (yeast)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145387.2-2665s1c1
Sequence:CCGGCGTCAGATGGTATCTAGCGTACTCGAGTACGCTAGATACCATCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145387.2-1530s1c1
Sequence:CCGGCAGAACTTCCACCCTGAGTTTCTCGAGAAACTCAGGGTGGAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145387.2-1945s1c1
Sequence:CCGGCCAGAGTATCTGTCTCTGGTACTCGAGTACCAGAGACAGATACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145387.2-2631s1c1
Sequence:CCGGGCTTTGAACTTCCTAGTCTTTCTCGAGAAAGACTAGGAAGTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145387.2-2166s1c1
Sequence:CCGGCCCAGAAATTCTTACGTGGTTCTCGAGAACCACGTAAGAATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145387.4-195s21c1
Sequence:CCGGATCATGACACCATCCATATAACTCGAGTTATATGGATGGTGTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145387.4-1215s1c1
Sequence:CCGGCCTTTCAGCTGTATTACTATTCTCGAGAATAGTAATACAGCTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145387.4-1944s21c1
Sequence:CCGGCCAGAGTATCTGTCTCTGGTACTCGAGTACCAGAGACAGATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145387.4-2631s21c1
Sequence:CCGGCTTTGAACTTCCTAGTCTTTGCTCGAGCAAAGACTAGGAAGTTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145387.4-1174s21c1
Sequence:CCGGTGGGACCCAGGAGATCCATATCTCGAGATATGGATCTCCTGGGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145387.4-559s21c1
Sequence:CCGGCCTGCATGGCCACGTACTTAACTCGAGTTAAGTACGTGGCCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145387
VALIDATED
ATHL1 MISSION shRNA shRNA Plasmid DNA
ATH1, acid trehalase-like 1 (yeast)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145387.2-2665s1c1
Sequence:CCGGCGTCAGATGGTATCTAGCGTACTCGAGTACGCTAGATACCATCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145387.2-1530s1c1
Sequence:CCGGCAGAACTTCCACCCTGAGTTTCTCGAGAAACTCAGGGTGGAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145387.2-1945s1c1
Sequence:CCGGCCAGAGTATCTGTCTCTGGTACTCGAGTACCAGAGACAGATACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145387.2-2631s1c1
Sequence:CCGGGCTTTGAACTTCCTAGTCTTTCTCGAGAAAGACTAGGAAGTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145387.2-2166s1c1
Sequence:CCGGCCCAGAAATTCTTACGTGGTTCTCGAGAACCACGTAAGAATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145387.4-195s21c1
Sequence:CCGGATCATGACACCATCCATATAACTCGAGTTATATGGATGGTGTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145387.4-1215s1c1
Sequence:CCGGCCTTTCAGCTGTATTACTATTCTCGAGAATAGTAATACAGCTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145387.4-1944s21c1
Sequence:CCGGCCAGAGTATCTGTCTCTGGTACTCGAGTACCAGAGACAGATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145387.4-2631s21c1
Sequence:CCGGCTTTGAACTTCCTAGTCTTTGCTCGAGCAAAGACTAGGAAGTTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145387.4-1174s21c1
Sequence:CCGGTGGGACCCAGGAGATCCATATCTCGAGATATGGATCTCCTGGGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145387.4-559s21c1
Sequence:CCGGCCTGCATGGCCACGTACTTAACTCGAGTTAAGTACGTGGCCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145387
VALIDATED
ATHL1 MISSION shRNA Lentiviral Transduction Particles
ATH1, acid trehalase-like 1 (yeast)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145387.2-2665s1c1
Sequence:CCGGCGTCAGATGGTATCTAGCGTACTCGAGTACGCTAGATACCATCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145387.2-1530s1c1
Sequence:CCGGCAGAACTTCCACCCTGAGTTTCTCGAGAAACTCAGGGTGGAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145387.2-1945s1c1
Sequence:CCGGCCAGAGTATCTGTCTCTGGTACTCGAGTACCAGAGACAGATACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145387.2-2631s1c1
Sequence:CCGGGCTTTGAACTTCCTAGTCTTTCTCGAGAAAGACTAGGAAGTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145387.2-2166s1c1
Sequence:CCGGCCCAGAAATTCTTACGTGGTTCTCGAGAACCACGTAAGAATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145387.4-195s21c1
Sequence:CCGGATCATGACACCATCCATATAACTCGAGTTATATGGATGGTGTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145387.4-1215s1c1
Sequence:CCGGCCTTTCAGCTGTATTACTATTCTCGAGAATAGTAATACAGCTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145387.4-1944s21c1
Sequence:CCGGCCAGAGTATCTGTCTCTGGTACTCGAGTACCAGAGACAGATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145387.4-2631s21c1
Sequence:CCGGCTTTGAACTTCCTAGTCTTTGCTCGAGCAAAGACTAGGAAGTTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145387.4-1174s21c1
Sequence:CCGGTGGGACCCAGGAGATCCATATCTCGAGATATGGATCTCCTGGGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145387.4-559s21c1
Sequence:CCGGCCTGCATGGCCACGTACTTAACTCGAGTTAAGTACGTGGCCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025092
ATHL1 MISSION shRNA Bacterial Glycerol Stock
ATH1, acid trehalase-like 1 (yeast)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025092.1-1521s1c1
Sequence:CCGGCTGGGCAGCTTTAATCAGGTTCTCGAGAACCTGATTAAAGCTGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025092.1-945s1c1
Sequence:CCGGGATCAAGGTACCCTTTGACGTCTCGAGACGTCAAAGGGTACCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180732    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025092.1-1112s1c1
Sequence:CCGGGTTCAAGGCTTTCTGCCTGTACTCGAGTACAGGCAGAAAGCCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025092.4-2308s21c1
Sequence:CCGGTGTGGACCCTGCCTCTGAATACTCGAGTATTCAGAGGCAGGGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025092.4-1719s21c1
Sequence:CCGGCCATGACCTGGAGCATGTTTGCTCGAGCAAACATGCTCCAGGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025092.4-1184s21c1
Sequence:CCGGGTTTGCCCTGAGGACATTTACCTCGAGGTAAATGTCCTCAGGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025092.4-1025s21c1
Sequence:CCGGCTCTGGATGTTCCCGAGTATCCTCGAGGATACTCGGGAACATCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025092.4-2998s21c1
Sequence:CCGGAGAGAACAGGAGAGGGATTTGCTCGAGCAAATCCCTCTCCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025092
ATHL1 MISSION shRNA shRNA Plasmid DNA
ATH1, acid trehalase-like 1 (yeast)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025092.1-1521s1c1
Sequence:CCGGCTGGGCAGCTTTAATCAGGTTCTCGAGAACCTGATTAAAGCTGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025092.1-945s1c1
Sequence:CCGGGATCAAGGTACCCTTTGACGTCTCGAGACGTCAAAGGGTACCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180732    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025092.1-1112s1c1
Sequence:CCGGGTTCAAGGCTTTCTGCCTGTACTCGAGTACAGGCAGAAAGCCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025092.4-2308s21c1
Sequence:CCGGTGTGGACCCTGCCTCTGAATACTCGAGTATTCAGAGGCAGGGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025092.4-1719s21c1
Sequence:CCGGCCATGACCTGGAGCATGTTTGCTCGAGCAAACATGCTCCAGGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025092.4-1184s21c1
Sequence:CCGGGTTTGCCCTGAGGACATTTACCTCGAGGTAAATGTCCTCAGGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025092.4-1025s21c1
Sequence:CCGGCTCTGGATGTTCCCGAGTATCCTCGAGGATACTCGGGAACATCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025092.4-2998s21c1
Sequence:CCGGAGAGAACAGGAGAGGGATTTGCTCGAGCAAATCCCTCTCCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025092
ATHL1 MISSION shRNA Lentiviral Transduction Particles
ATH1, acid trehalase-like 1 (yeast)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025092.1-1521s1c1
Sequence:CCGGCTGGGCAGCTTTAATCAGGTTCTCGAGAACCTGATTAAAGCTGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025092.1-945s1c1
Sequence:CCGGGATCAAGGTACCCTTTGACGTCTCGAGACGTCAAAGGGTACCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180732    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025092.1-1112s1c1
Sequence:CCGGGTTCAAGGCTTTCTGCCTGTACTCGAGTACAGGCAGAAAGCCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025092.4-2308s21c1
Sequence:CCGGTGTGGACCCTGCCTCTGAATACTCGAGTATTCAGAGGCAGGGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025092.4-1719s21c1
Sequence:CCGGCCATGACCTGGAGCATGTTTGCTCGAGCAAACATGCTCCAGGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025092.4-1184s21c1
Sequence:CCGGGTTTGCCCTGAGGACATTTACCTCGAGGTAAATGTCCTCAGGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025092.4-1025s21c1
Sequence:CCGGCTCTGGATGTTCCCGAGTATCCTCGAGGATACTCGGGAACATCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025092.4-2998s21c1
Sequence:CCGGAGAGAACAGGAGAGGGATTTGCTCGAGCAAATCCCTCTCCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks