EMAIL THIS PAGE TO A FRIEND

ATIC

5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase

59 Gene Product Result for
Synonyms: AICAR AICARFT IMPCHASE PURH
UniProtKB ID: P31939, Q13856, Q53S28
Gene ID:
Human(471) Summary: This gene encodes a bifunctional protein that catalyzes the last two steps of the de novo purine biosynthetic pathway. The N-terminal domain has phosphoribosylaminoimidazolecarboxamide formyltransferase activity, and the C-terminal domain has IMP cyclohydrolase activity. A mutation in this gene results in AICA-ribosiduria. [provided by RefSeq, Sep 2009]
Mouse(108147) 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Rat(81643) 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Zebrafish(140622) 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
dog(488513) 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Horse(100054298) 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
cow(506343) 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
domestic cat(101081485) 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
chicken(396091) 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
naked mole-rat(101721008) 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
domestic guinea pig(100726313) 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
sheep(101105137) 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Domestic Rabbit(100346623) 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004044 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026195 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026195 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026195 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004044 Rosetta Predictions human pricing
NM_031014 Rosetta Predictions rat pricing
NM_026195 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095755 predicted 1359
2 SASI_Hs01_00095756 predicted 1122
3 SASI_Hs02_00336798 predicted 1175
4 SASI_Hs01_00095757 predicted 1576
5 SASI_Hs01_00095758 predicted 689
6 SASI_Hs01_00095759 predicted 791
7 SASI_Hs01_00095761 predicted 710
8 SASI_Hs02_00336799 predicted 1756
9 SASI_Hs01_00095763 predicted 542
10 SASI_Hs02_00336800 predicted 714
11 SASI_Hs01_00095754 predicted 320
12 SASI_Hs01_00095760 predicted 1618
13 SASI_Hs01_00095762 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109027 predicted 277
2 SASI_Rn01_00109028 predicted 1230
3 SASI_Rn01_00109029 predicted 1329
4 SASI_Rn01_00109030 predicted 1240
5 SASI_Rn01_00109031 predicted 318
6 SASI_Rn01_00109032 predicted 615
7 SASI_Rn01_00109033 predicted 662
8 SASI_Rn01_00109034 predicted 1251
9 SASI_Rn02_00264205 predicted 1760
10 SASI_Rn01_00109035 predicted 257
11 SASI_Rn01_00109026 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026195 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329860 predicted 1246
2 SASI_Mm01_00138520 predicted 638
3 SASI_Mm02_00329861 predicted 1775
4 SASI_Mm01_00138522 predicted 1864
5 SASI_Mm01_00138523 predicted 613
6 SASI_Mm01_00138526 predicted 1916
7 SASI_Mm01_00138527 predicted 658
8 SASI_Mm02_00329862 predicted 1348
9 SASI_Mm01_00138529 predicted 344
10 SASI_Mm02_00329863 predicted 223
11 SASI_Mm01_00138521 predicted 1879
12 SASI_Mm01_00138524 predicted 241
13 SASI_Mm01_00138525 predicted 1082
14 SASI_Mm01_00138528 predicted 679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004044
VALIDATED
ATIC MISSION shRNA Bacterial Glycerol Stock
5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004044.5-1546s21c1
Sequence:CCGGGCAGGAGATAAGGCAAACTATCTCGAGATAGTTTGCCTTATCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004044.5-394s21c1
Sequence:CCGGGCTGGAATCCTAGCTCGTAATCTCGAGATTACGAGCTAGGATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004044.5-1222s21c1
Sequence:CCGGGCCTTGACAATACTTTCCAAACTCGAGTTTGGAAAGTATTGTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004044.5-476s21c1
Sequence:CCGGGCAATCTCTATCCCTTTGTAACTCGAGTTACAAAGGGATAGAGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004044.4-332s1c1
Sequence:CCGGGCAATCTCTATCCCTTTGTAACTCGAGTTACAAAGGGATAGAGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004044.4-575s1c1
Sequence:CCGGCGGCACAATATGATGAAGCAACTCGAGTTGCTTCATCATATTGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004044.4-1402s1c1
Sequence:CCGGGCAGGAGATAAGGCAAACTATCTCGAGATAGTTTGCCTTATCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004044.4-1078s1c1
Sequence:CCGGGCCTTGACAATACTTTCCAAACTCGAGTTTGGAAAGTATTGTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004044.4-250s1c1
Sequence:CCGGGCTGGAATCCTAGCTCGTAATCTCGAGATTACGAGCTAGGATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004044
VALIDATED
ATIC MISSION shRNA shRNA Plasmid DNA
5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004044.5-1546s21c1
Sequence:CCGGGCAGGAGATAAGGCAAACTATCTCGAGATAGTTTGCCTTATCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004044.5-394s21c1
Sequence:CCGGGCTGGAATCCTAGCTCGTAATCTCGAGATTACGAGCTAGGATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004044.5-1222s21c1
Sequence:CCGGGCCTTGACAATACTTTCCAAACTCGAGTTTGGAAAGTATTGTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004044.5-476s21c1
Sequence:CCGGGCAATCTCTATCCCTTTGTAACTCGAGTTACAAAGGGATAGAGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004044.4-332s1c1
Sequence:CCGGGCAATCTCTATCCCTTTGTAACTCGAGTTACAAAGGGATAGAGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004044.4-575s1c1
Sequence:CCGGCGGCACAATATGATGAAGCAACTCGAGTTGCTTCATCATATTGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004044.4-1402s1c1
Sequence:CCGGGCAGGAGATAAGGCAAACTATCTCGAGATAGTTTGCCTTATCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004044.4-1078s1c1
Sequence:CCGGGCCTTGACAATACTTTCCAAACTCGAGTTTGGAAAGTATTGTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004044.4-250s1c1
Sequence:CCGGGCTGGAATCCTAGCTCGTAATCTCGAGATTACGAGCTAGGATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004044
VALIDATED
ATIC MISSION shRNA Lentiviral Transduction Particles
5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004044.5-1546s21c1
Sequence:CCGGGCAGGAGATAAGGCAAACTATCTCGAGATAGTTTGCCTTATCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004044.5-394s21c1
Sequence:CCGGGCTGGAATCCTAGCTCGTAATCTCGAGATTACGAGCTAGGATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004044.5-1222s21c1
Sequence:CCGGGCCTTGACAATACTTTCCAAACTCGAGTTTGGAAAGTATTGTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004044.5-476s21c1
Sequence:CCGGGCAATCTCTATCCCTTTGTAACTCGAGTTACAAAGGGATAGAGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004044.4-332s1c1
Sequence:CCGGGCAATCTCTATCCCTTTGTAACTCGAGTTACAAAGGGATAGAGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004044.4-575s1c1
Sequence:CCGGCGGCACAATATGATGAAGCAACTCGAGTTGCTTCATCATATTGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004044.4-1402s1c1
Sequence:CCGGGCAGGAGATAAGGCAAACTATCTCGAGATAGTTTGCCTTATCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004044.4-1078s1c1
Sequence:CCGGGCCTTGACAATACTTTCCAAACTCGAGTTTGGAAAGTATTGTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004044.4-250s1c1
Sequence:CCGGGCTGGAATCCTAGCTCGTAATCTCGAGATTACGAGCTAGGATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026195
VALIDATED
ATIC MISSION shRNA Bacterial Glycerol Stock
5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026195.1-2288s1c1
Sequence:CCGGGCTCTTTCTTTCTCCAGAATTCTCGAGAATTCTGGAGAAAGAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026195.1-628s1c1
Sequence:CCGGCCGCTCAATACGATGAAGCAACTCGAGTTGCTTCATCGTATTGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026195.1-1497s1c1
Sequence:CCGGCGAGTGCTGTCCATGAAGTTTCTCGAGAAACTTCATGGACAGCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026195.1-982s1c1
Sequence:CCGGCCGTTGCATATGCAAGAGCAACTCGAGTTGCTCTTGCATATGCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026195.1-348s1c1
Sequence:CCGGGCCAGGCTTGATTTCAACCTTCTCGAGAAGGTTGAAATCAAGCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026195
VALIDATED
ATIC MISSION shRNA shRNA Plasmid DNA
5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026195.1-2288s1c1
Sequence:CCGGGCTCTTTCTTTCTCCAGAATTCTCGAGAATTCTGGAGAAAGAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026195.1-628s1c1
Sequence:CCGGCCGCTCAATACGATGAAGCAACTCGAGTTGCTTCATCGTATTGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026195.1-1497s1c1
Sequence:CCGGCGAGTGCTGTCCATGAAGTTTCTCGAGAAACTTCATGGACAGCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026195.1-982s1c1
Sequence:CCGGCCGTTGCATATGCAAGAGCAACTCGAGTTGCTCTTGCATATGCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026195.1-348s1c1
Sequence:CCGGGCCAGGCTTGATTTCAACCTTCTCGAGAAGGTTGAAATCAAGCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026195
VALIDATED
ATIC MISSION shRNA Lentiviral Transduction Particles
5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026195.1-2288s1c1
Sequence:CCGGGCTCTTTCTTTCTCCAGAATTCTCGAGAATTCTGGAGAAAGAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026195.1-628s1c1
Sequence:CCGGCCGCTCAATACGATGAAGCAACTCGAGTTGCTTCATCGTATTGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026195.1-1497s1c1
Sequence:CCGGCGAGTGCTGTCCATGAAGTTTCTCGAGAAACTTCATGGACAGCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026195.1-982s1c1
Sequence:CCGGCCGTTGCATATGCAAGAGCAACTCGAGTTGCTCTTGCATATGCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026195.1-348s1c1
Sequence:CCGGGCCAGGCTTGATTTCAACCTTCTCGAGAAGGTTGAAATCAAGCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)