EMAIL THIS PAGE TO A FRIEND

ATL1

atlastin GTPase 1

Synonyms: AD-FSP FSP1 GBP3 HSN1D SPG3 SPG3A atlastin1
Gene ID:
Human(51062) Summary: The protein encoded by this gene is a GTPase and a Golgi body transmembrane protein. The encoded protein can form a homotetramer and has been shown to interact with spastin and with mitogen-activated protein kinase kinase kinase kinase 4. This protein may be involved in axonal maintenance as evidenced by the fact that defects in this gene are a cause of spastic paraplegia type 3. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(73991) atlastin GTPase 1
Rat(362750) atlastin GTPase 1
Zebrafish(571909) atlastin GTPase 1
cow(535424) atlastin GTPase 1
domestic cat(101095747) atlastin GTPase 1
dog(480318) atlastin GTPase 1
chicken(423577) atlastin GTPase 1
sheep(101104070) atlastin GTPase 1
domestic guinea pig(100720885) atlastin GTPase 1
naked mole-rat(101696537) atlastin GTPase 1
127 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015915 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015915 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015915 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178628 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178628 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178628 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127713 Rosetta Predictions human pricing
NM_015915 Rosetta Predictions human pricing
NM_181598 Rosetta Predictions human pricing
NM_001009831 Rosetta Predictions rat pricing
XM_579316 Rosetta Predictions rat pricing
NM_178628 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330324 predicted 1045
2 SASI_Hs02_00330325 predicted 675
3 SASI_Hs02_00330326 predicted 1251
4 SASI_Hs02_00330327 predicted 927
5 SASI_Hs02_00330328 predicted 565
6 SASI_Hs02_00330329 predicted 1196
7 SASI_Hs02_00330330 predicted 1585
8 SASI_Hs02_00330331 predicted 784
9 SASI_Hs02_00330332 predicted 1814
10 SASI_Hs02_00330333 predicted 1411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348529 predicted 847
2 SASI_Hs01_00225766 predicted 481
3 SASI_Hs02_00348530 predicted 508
4 SASI_Hs01_00225768 predicted 1064
5 SASI_Hs01_00225769 predicted 742
6 SASI_Hs01_00225770 predicted 372
7 SASI_Hs01_00225771 predicted 1000
8 SASI_Hs01_00225772 predicted 1394
9 SASI_Hs01_00225773 predicted 591
10 SASI_Hs01_00225774 predicted 1375
11 SASI_Hs01_00225765 predicted 851
12 SASI_Hs01_00225767 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370188 predicted 849
2 SASI_Hs01_00221503 predicted 485
3 SASI_Hs02_00370189 predicted 509
4 SASI_Hs01_00221505 predicted 1062
5 SASI_Hs01_00221506 predicted 736
6 SASI_Hs01_00221507 predicted 373
7 SASI_Hs01_00221508 predicted 999
8 SASI_Hs01_00221509 predicted 1388
9 SASI_Hs01_00221510 predicted 594
10 SASI_Hs01_00221511 predicted 1376
11 SASI_Hs01_00221502 predicted 852
12 SASI_Hs01_00221504 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009831 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034614 predicted 1771
2 SASI_Rn01_00034615 predicted 1917
3 SASI_Rn01_00034616 predicted 724
4 SASI_Rn01_00034617 predicted 371
5 SASI_Rn01_00034618 predicted 673
6 SASI_Rn01_00034619 predicted 332
7 SASI_Rn01_00034620 predicted 821
8 SASI_Rn02_00199790 predicted 463
9 SASI_Rn01_00034621 predicted 498
10 SASI_Rn01_00034623 predicted 1609
11 SASI_Rn01_00034622 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579316 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167196 predicted 516
2 SASI_Rn01_00167197 predicted 458
3 SASI_Rn01_00167198 predicted 604
4 SASI_Rn01_00167199 predicted 248
5 SASI_Rn01_00167200 predicted 285
6 SASI_Rn01_00167201 predicted 269
7 SASI_Rn01_00167202 predicted 1056
8 SASI_Rn01_00167203 predicted 744
9 SASI_Rn01_00167204 predicted 1392
10 SASI_Rn01_00167205 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178628 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190885 predicted 751
2 SASI_Mm01_00190886 predicted 683
3 SASI_Mm01_00190887 predicted 1292
4 SASI_Mm01_00190888 predicted 1507
5 SASI_Mm01_00190889 predicted 1789
6 SASI_Mm01_00190890 predicted 1932
7 SASI_Mm01_00190891 predicted 1783
8 SASI_Mm01_00190892 predicted 1861
9 SASI_Mm01_00190893 predicted 1376
10 SASI_Mm01_00190894 predicted 510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015915
VALIDATED
ATL1 MISSION shRNA Bacterial Glycerol Stock
atlastin GTPase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015915.2-2274s1c1
Sequence:CCGGGCTGGATTTAATCTGTATCATCTCGAGATGATACAGATTAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015915.2-943s1c1
Sequence:CCGGCCATTCCTGTTTCACCAACATCTCGAGATGTTGGTGAAACAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015915.2-679s1c1
Sequence:CCGGGATCAGCTCAATACAGGTATACTCGAGTATACCTGTATTGAGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015915.2-285s1c1
Sequence:CCGGTCATTGTCAAAGATGACCATTCTCGAGAATGGTCATCTTTGACAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015915.2-1321s1c1
Sequence:CCGGCCCAAATGACTTGCAGACCAACTCGAGTTGGTCTGCAAGTCATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015915
VALIDATED
ATL1 MISSION shRNA shRNA Plasmid DNA
atlastin GTPase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015915.2-2274s1c1
Sequence:CCGGGCTGGATTTAATCTGTATCATCTCGAGATGATACAGATTAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015915.2-943s1c1
Sequence:CCGGCCATTCCTGTTTCACCAACATCTCGAGATGTTGGTGAAACAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015915.2-679s1c1
Sequence:CCGGGATCAGCTCAATACAGGTATACTCGAGTATACCTGTATTGAGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015915.2-285s1c1
Sequence:CCGGTCATTGTCAAAGATGACCATTCTCGAGAATGGTCATCTTTGACAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015915.2-1321s1c1
Sequence:CCGGCCCAAATGACTTGCAGACCAACTCGAGTTGGTCTGCAAGTCATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015915
VALIDATED
ATL1 MISSION shRNA Lentiviral Transduction Particles
atlastin GTPase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015915.2-2274s1c1
Sequence:CCGGGCTGGATTTAATCTGTATCATCTCGAGATGATACAGATTAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015915.2-943s1c1
Sequence:CCGGCCATTCCTGTTTCACCAACATCTCGAGATGTTGGTGAAACAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015915.2-679s1c1
Sequence:CCGGGATCAGCTCAATACAGGTATACTCGAGTATACCTGTATTGAGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015915.2-285s1c1
Sequence:CCGGTCATTGTCAAAGATGACCATTCTCGAGAATGGTCATCTTTGACAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015915.2-1321s1c1
Sequence:CCGGCCCAAATGACTTGCAGACCAACTCGAGTTGGTCTGCAAGTCATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178628
ATL1 MISSION shRNA Bacterial Glycerol Stock
atlastin GTPase 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178628.3-1507s1c1
Sequence:CCGGGATGAACTCTACATCCAGTATCTCGAGATACTGGATGTAGAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178628.3-1784s1c1
Sequence:CCGGGAAGCACAAATGAGGCGTTATCTCGAGATAACGCCTCATTTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178628.4-1145s21c1
Sequence:CCGGGAGTCCTGAGCGTCTAGATATCTCGAGATATCTAGACGCTCAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178628.4-1710s21c1
Sequence:CCGGATCCGCTACTCTGGCGAATATCTCGAGATATTCGCCAGAGTAGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178628.4-2183s21c1
Sequence:CCGGGTTCTACTACTGGGTTATAATCTCGAGATTATAACCCAGTAGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178628.4-1509s21c1
Sequence:CCGGGAACTCTACATCCAGTATATTCTCGAGAATATACTGGATGTAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178628.4-885s21c1
Sequence:CCGGTGGAGTTTCCCATACGAATTTCTCGAGAAATTCGTATGGGAAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178628
ATL1 MISSION shRNA shRNA Plasmid DNA
atlastin GTPase 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178628.3-1507s1c1
Sequence:CCGGGATGAACTCTACATCCAGTATCTCGAGATACTGGATGTAGAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178628.3-1784s1c1
Sequence:CCGGGAAGCACAAATGAGGCGTTATCTCGAGATAACGCCTCATTTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178628.4-1145s21c1
Sequence:CCGGGAGTCCTGAGCGTCTAGATATCTCGAGATATCTAGACGCTCAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178628.4-1710s21c1
Sequence:CCGGATCCGCTACTCTGGCGAATATCTCGAGATATTCGCCAGAGTAGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178628.4-2183s21c1
Sequence:CCGGGTTCTACTACTGGGTTATAATCTCGAGATTATAACCCAGTAGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178628.4-1509s21c1
Sequence:CCGGGAACTCTACATCCAGTATATTCTCGAGAATATACTGGATGTAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178628.4-885s21c1
Sequence:CCGGTGGAGTTTCCCATACGAATTTCTCGAGAAATTCGTATGGGAAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178628
ATL1 MISSION shRNA Lentiviral Transduction Particles
atlastin GTPase 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178628.3-1507s1c1
Sequence:CCGGGATGAACTCTACATCCAGTATCTCGAGATACTGGATGTAGAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178628.3-1784s1c1
Sequence:CCGGGAAGCACAAATGAGGCGTTATCTCGAGATAACGCCTCATTTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178628.4-1145s21c1
Sequence:CCGGGAGTCCTGAGCGTCTAGATATCTCGAGATATCTAGACGCTCAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178628.4-1710s21c1
Sequence:CCGGATCCGCTACTCTGGCGAATATCTCGAGATATTCGCCAGAGTAGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178628.4-2183s21c1
Sequence:CCGGGTTCTACTACTGGGTTATAATCTCGAGATTATAACCCAGTAGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178628.4-1509s21c1
Sequence:CCGGGAACTCTACATCCAGTATATTCTCGAGAATATACTGGATGTAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178628.4-885s21c1
Sequence:CCGGTGGAGTTTCCCATACGAATTTCTCGAGAAATTCGTATGGGAAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks