EMAIL THIS PAGE TO A FRIEND

ATL2

atlastin GTPase 2

188 Gene Product Result for
Synonyms: ARL3IP2 ARL6IP2 atlastin2
UniProtKB ID: Q8NHH9, B7Z1X2, Q4ZG30, Q7Z630, Q8NHH8, Q9H5M7
Gene ID:
Mouse(56298) atlastin GTPase 2
Rat(298757) atlastin GTPase 2
Zebrafish(323665) atlastin GTPase 2
Thale Cress(820924) RING-H2 finger protein ATL2
dog(475728) atlastin GTPase 2
cow(100140212) atlastin GTPase 2
domestic cat(101099370) atlastin GTPase 2
chicken(100859117) atlastin GTPase 2
naked mole-rat(101701433) atlastin GTPase 2
domestic guinea pig(100719797) atlastin GTPase 2
Domestic Rabbit(100338969) atlastin GTPase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019717 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019717 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019717 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022374 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121571 MISSION® esiRNA esiRNA human ATL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022374 Rosetta Predictions human pricing
XM_001063138 Rosetta Predictions rat pricing
XM_216629 Rosetta Predictions rat pricing
NM_019717 Rosetta Predictions mouse pricing
NM_178050 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214890 predicted 1532
2 SASI_Hs01_00214891 predicted 215
3 SASI_Hs01_00214892 predicted 902
4 SASI_Hs01_00214893 predicted 404
5 SASI_Hs02_00355679 predicted 741
6 SASI_Hs01_00214894 predicted 1436
7 SASI_Hs01_00214895 predicted 1501
8 SASI_Hs02_00355680 predicted 648
9 SASI_Hs01_00214896 predicted 205
10 SASI_Hs01_00214897 predicted 451
11 SASI_Hs01_00214898 predicted 368
12 SASI_Hs01_00214899 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305950 predicted 1663
2 SASI_Rn02_00305951 predicted 1687
3 SASI_Rn02_00305952 predicted 1117
4 SASI_Rn02_00305953 predicted 986
5 SASI_Rn02_00305954 predicted 1445
6 SASI_Rn02_00305955 predicted 1132
7 SASI_Rn02_00305956 predicted 530
8 SASI_Rn02_00305957 predicted 820
9 SASI_Rn02_00305958 predicted 917
10 SASI_Rn02_00305959 predicted 1569
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376700 predicted 1662
2 SASI_Rn02_00376701 predicted 1689
3 SASI_Rn02_00376702 predicted 1122
4 SASI_Rn02_00376703 predicted 987
5 SASI_Rn02_00376704 predicted 1444
6 SASI_Rn02_00376705 predicted 1128
7 SASI_Rn02_00376706 predicted 538
8 SASI_Rn02_00376707 predicted 821
9 SASI_Rn02_00376708 predicted 918
10 SASI_Rn02_00376709 predicted 1565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019717 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324833 predicted 944
2 SASI_Mm02_00324834 predicted 1047
3 SASI_Mm01_00036166 predicted 1438
4 SASI_Mm02_00324835 predicted 919
5 SASI_Mm02_00324836 predicted 1233
6 SASI_Mm02_00324837 predicted 1722
7 SASI_Mm02_00324838 predicted 1583
8 SASI_Mm02_00324839 predicted 1040
9 SASI_Mm02_00324840 predicted 1790
10 SASI_Mm02_00324841 predicted 1728
11 SASI_Mm01_00036165 predicted 214
12 SASI_Mm01_00036167 predicted 241
13 SASI_Mm01_00036168 predicted 216
14 SASI_Mm01_00036169 predicted 262
15 SASI_Mm01_00036170 predicted 271
16 SASI_Mm01_00036171 predicted 272
17 SASI_Mm01_00036172 predicted 221
18 SASI_Mm01_00036173 predicted 223
19 SASI_Mm01_00036174 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178050 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348505 predicted 786
2 SASI_Mm02_00348506 predicted 891
3 SASI_Mm01_00110937 predicted 1289
4 SASI_Mm02_00348507 predicted 774
5 SASI_Mm01_00110940 predicted 1082
6 SASI_Mm01_00110941 predicted 1569
7 SASI_Mm01_00110942 predicted 1433
8 SASI_Mm02_00348508 predicted 893
9 SASI_Mm01_00110943 predicted 1638
10 SASI_Mm01_00110944 predicted 1582
11 SASI_Mm01_00110938 predicted 1647
12 SASI_Mm01_00110939 predicted 2229
13 SASI_Mm01_00110945 predicted 2225
14 SASI_Mm01_00110946 predicted 1947
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019717
ATL2 MISSION shRNA Bacterial Glycerol Stock
atlastin GTPase 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019717.2-537s1c1
Sequence:CCGGGATAGCCAGTCAACCATTAAACTCGAGTTTAATGGTTGACTGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019717.1-127s1c1
Sequence:CCGGGCTGAAATCGAAGAAACCTATCTCGAGATAGGTTTCTTCGATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019717.1-218s1c1
Sequence:CCGGCAGTCATGTTTGCTATGTATACTCGAGTATACATAGCAAACATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019717.1-364s1c1
Sequence:CCGGGAAATCGGAACAATGATTGATCTCGAGATCAATCATTGTTCCGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019717.1-357s1c1
Sequence:CCGGGTTCAGAGAAATCGGAACAATCTCGAGATTGTTCCGATTTCTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019717.1-369s1c1
Sequence:CCGGCGGAACAATGATTGATCAGATCTCGAGATCTGATCAATCATTGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019717
ATL2 MISSION shRNA shRNA Plasmid DNA
atlastin GTPase 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019717.2-537s1c1
Sequence:CCGGGATAGCCAGTCAACCATTAAACTCGAGTTTAATGGTTGACTGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019717.1-127s1c1
Sequence:CCGGGCTGAAATCGAAGAAACCTATCTCGAGATAGGTTTCTTCGATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019717.1-218s1c1
Sequence:CCGGCAGTCATGTTTGCTATGTATACTCGAGTATACATAGCAAACATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019717.1-364s1c1
Sequence:CCGGGAAATCGGAACAATGATTGATCTCGAGATCAATCATTGTTCCGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019717.1-357s1c1
Sequence:CCGGGTTCAGAGAAATCGGAACAATCTCGAGATTGTTCCGATTTCTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019717.1-369s1c1
Sequence:CCGGCGGAACAATGATTGATCAGATCTCGAGATCTGATCAATCATTGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019717
ATL2 MISSION shRNA Lentiviral Transduction Particles
atlastin GTPase 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019717.2-537s1c1
Sequence:CCGGGATAGCCAGTCAACCATTAAACTCGAGTTTAATGGTTGACTGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019717.1-127s1c1
Sequence:CCGGGCTGAAATCGAAGAAACCTATCTCGAGATAGGTTTCTTCGATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019717.1-218s1c1
Sequence:CCGGCAGTCATGTTTGCTATGTATACTCGAGTATACATAGCAAACATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019717.1-364s1c1
Sequence:CCGGGAAATCGGAACAATGATTGATCTCGAGATCAATCATTGTTCCGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019717.1-357s1c1
Sequence:CCGGGTTCAGAGAAATCGGAACAATCTCGAGATTGTTCCGATTTCTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019717.1-369s1c1
Sequence:CCGGCGGAACAATGATTGATCAGATCTCGAGATCTGATCAATCATTGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022374
ATL2 MISSION shRNA Bacterial Glycerol Stock
atlastin GTPase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022374.1-266s1c1
Sequence:CCGGCTACAGGAGCACATACGAGATCTCGAGATCTCGTATGTGCTCCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022374.1-548s1c1
Sequence:CCGGGATAGCCAGTCAACTATCAAACTCGAGTTTGATAGTTGACTGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022374.1-982s1c1
Sequence:CCGGGCTTCGAAATCTGGTTCCATTCTCGAGAATGGAACCAGATTTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022374.1-1349s1c1
Sequence:CCGGGACCAGCTTGAAGCTGAAATTCTCGAGAATTTCAGCTTCAAGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022374.1-1717s1c1
Sequence:CCGGGAGACTGTCATCCAACAATAACTCGAGTTATTGTTGGATGACAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022374.1-185s1c1
Sequence:CCGGCCATGTCCAGTACAGATTGTTCTCGAGAACAATCTGTACTGGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022374.1-1868s1c1
Sequence:CCGGGCTGCATATAGGGTATGGAATCTCGAGATTCCATACCCTATATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022374.1-1830s1c1
Sequence:CCGGCCGGTCTGCATAAATGCTGTACTCGAGTACAGCATTTATGCAGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022374.1-540s1c1
Sequence:CCGGGTGCCTTTGATAGCCAGTCAACTCGAGTTGACTGGCTATCAAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022374.1-1325s1c1
Sequence:CCGGGATGAGTTCTGCCGTCGTTATCTCGAGATAACGACGGCAGAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022374
ATL2 MISSION shRNA shRNA Plasmid DNA
atlastin GTPase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022374.1-266s1c1
Sequence:CCGGCTACAGGAGCACATACGAGATCTCGAGATCTCGTATGTGCTCCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022374.1-548s1c1
Sequence:CCGGGATAGCCAGTCAACTATCAAACTCGAGTTTGATAGTTGACTGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022374.1-982s1c1
Sequence:CCGGGCTTCGAAATCTGGTTCCATTCTCGAGAATGGAACCAGATTTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022374.1-1349s1c1
Sequence:CCGGGACCAGCTTGAAGCTGAAATTCTCGAGAATTTCAGCTTCAAGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022374.1-1717s1c1
Sequence:CCGGGAGACTGTCATCCAACAATAACTCGAGTTATTGTTGGATGACAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022374.1-185s1c1
Sequence:CCGGCCATGTCCAGTACAGATTGTTCTCGAGAACAATCTGTACTGGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022374.1-1868s1c1
Sequence:CCGGGCTGCATATAGGGTATGGAATCTCGAGATTCCATACCCTATATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022374.1-1830s1c1
Sequence:CCGGCCGGTCTGCATAAATGCTGTACTCGAGTACAGCATTTATGCAGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022374.1-540s1c1
Sequence:CCGGGTGCCTTTGATAGCCAGTCAACTCGAGTTGACTGGCTATCAAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022374.1-1325s1c1
Sequence:CCGGGATGAGTTCTGCCGTCGTTATCTCGAGATAACGACGGCAGAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022374
ATL2 MISSION shRNA Lentiviral Transduction Particles
atlastin GTPase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022374.1-266s1c1
Sequence:CCGGCTACAGGAGCACATACGAGATCTCGAGATCTCGTATGTGCTCCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022374.1-548s1c1
Sequence:CCGGGATAGCCAGTCAACTATCAAACTCGAGTTTGATAGTTGACTGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022374.1-982s1c1
Sequence:CCGGGCTTCGAAATCTGGTTCCATTCTCGAGAATGGAACCAGATTTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022374.1-1349s1c1
Sequence:CCGGGACCAGCTTGAAGCTGAAATTCTCGAGAATTTCAGCTTCAAGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022374.1-1717s1c1
Sequence:CCGGGAGACTGTCATCCAACAATAACTCGAGTTATTGTTGGATGACAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022374.1-185s1c1
Sequence:CCGGCCATGTCCAGTACAGATTGTTCTCGAGAACAATCTGTACTGGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022374.1-1868s1c1
Sequence:CCGGGCTGCATATAGGGTATGGAATCTCGAGATTCCATACCCTATATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022374.1-1830s1c1
Sequence:CCGGCCGGTCTGCATAAATGCTGTACTCGAGTACAGCATTTATGCAGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022374.1-540s1c1
Sequence:CCGGGTGCCTTTGATAGCCAGTCAACTCGAGTTGACTGGCTATCAAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022374.1-1325s1c1
Sequence:CCGGGATGAGTTCTGCCGTCGTTATCTCGAGATAACGACGGCAGAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks