EMAIL THIS PAGE TO A FRIEND

ATL3

atlastin GTPase 3

57 Gene Product Result for
UniProtKB ID: Q6DD88, Q8N7W5, Q9H8Q5, Q9UFL1
Gene ID:
Mouse(109168) atlastin GTPase 3
Rat(309187) atlastin GTPase 3
sheep(101120873) atlastin GTPase 3
Domestic Rabbit(100358470) atlastin GTPase 3
domestic guinea pig(100731375) atlastin GTPase 3
naked mole-rat(101711686) atlastin GTPase 3
Zebrafish(449995) atlastin 3
Thale Cress(843563) RING-H2 finger protein ATL3
cow(515124) atlastin GTPase 3
domestic cat(101094700) atlastin GTPase 3
dog(476044) atlastin GTPase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015459 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146091 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146091 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146091 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_027566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015459 Rosetta Predictions human pricing
NM_001044241 Rosetta Predictions rat pricing
NM_146091 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347872 predicted 972
2 SASI_Hs01_00225346 predicted 1476
3 SASI_Hs02_00347873 predicted 530
4 SASI_Hs02_00347874 predicted 1747
5 SASI_Hs01_00225347 predicted 612
6 SASI_Hs01_00225348 predicted 722
7 SASI_Hs01_00225349 predicted 913
8 SASI_Hs02_00347875 predicted 914
9 SASI_Hs02_00347876 predicted 886
10 SASI_Hs01_00225352 predicted 365
11 SASI_Hs01_00225344 predicted 1454
12 SASI_Hs01_00225345 predicted 1749
13 SASI_Hs01_00225350 predicted 1170
14 SASI_Hs01_00225351 predicted 1160
15 SASI_Hs01_00225353 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205137 predicted 598
2 SASI_Rn02_00205138 predicted 1249
3 SASI_Rn02_00205139 predicted 511
4 SASI_Rn02_00205140 predicted 1721
5 SASI_Rn02_00205141 predicted 705
6 SASI_Rn02_00205142 predicted 741
7 SASI_Rn02_00205143 predicted 593
8 SASI_Rn02_00205144 predicted 1132
9 SASI_Rn02_00205145 predicted 1376
10 SASI_Rn02_00205146 predicted 1108
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024433 predicted 497
2 SASI_Mm01_00024434 predicted 905
3 SASI_Mm01_00024435 predicted 251
4 SASI_Mm02_00341728 predicted 415
5 SASI_Mm01_00024436 predicted 524
6 SASI_Mm01_00024437 predicted 773
7 SASI_Mm01_00024438 predicted 917
8 SASI_Mm02_00341729 predicted 1211
9 SASI_Mm01_00024439 predicted 933
10 SASI_Mm01_00024440 predicted 379
11 SASI_Mm01_00024432 predicted 387
12 SASI_Mm01_00024441 predicted 1037
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015459
VALIDATED
ATL3 MISSION shRNA Bacterial Glycerol Stock
atlastin GTPase 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015459.3-1100s1c1
Sequence:CCGGGCCCTGACTTTGATGGGAAATCTCGAGATTTCCCATCAAAGTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015459.3-1700s1c1
Sequence:CCGGGTATGGTTGGACTACTGTTAACTCGAGTTAACAGTAGTCCAACCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015459.3-379s1c1
Sequence:CCGGGATCAACATTCCTTTGAGCTACTCGAGTAGCTCAAAGGAATGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015459.3-1402s1c1
Sequence:CCGGCCTTATTTGTCTCCAGACATTCTCGAGAATGTCTGGAGACAAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015459.3-1816s1c1
Sequence:CCGGGCTTCTTCTCATATCGGTAATCTCGAGATTACCGATATGAGAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134997    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015459.3-1911s1c1
Sequence:CCGGCGTGAAGATCAAACAAGAACACTCGAGTGTTCTTGTTTGATCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015459.3-886s1c1
Sequence:CCGGCCTTTCCAGACACTGATGTTTCTCGAGAAACATCAGTGTCTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015459.3-856s1c1
Sequence:CCGGCGTCTGGCAATGGATGAAATTCTCGAGAATTTCATCCATTGCCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015459.3-1743s1c1
Sequence:CCGGCATCAGGTATTCTGGTCAATACTCGAGTATTGACCAGAATACCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015459
VALIDATED
ATL3 MISSION shRNA shRNA Plasmid DNA
atlastin GTPase 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015459.3-1100s1c1
Sequence:CCGGGCCCTGACTTTGATGGGAAATCTCGAGATTTCCCATCAAAGTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015459.3-1700s1c1
Sequence:CCGGGTATGGTTGGACTACTGTTAACTCGAGTTAACAGTAGTCCAACCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015459.3-379s1c1
Sequence:CCGGGATCAACATTCCTTTGAGCTACTCGAGTAGCTCAAAGGAATGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015459.3-1402s1c1
Sequence:CCGGCCTTATTTGTCTCCAGACATTCTCGAGAATGTCTGGAGACAAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015459.3-1816s1c1
Sequence:CCGGGCTTCTTCTCATATCGGTAATCTCGAGATTACCGATATGAGAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134997    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015459.3-1911s1c1
Sequence:CCGGCGTGAAGATCAAACAAGAACACTCGAGTGTTCTTGTTTGATCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015459.3-886s1c1
Sequence:CCGGCCTTTCCAGACACTGATGTTTCTCGAGAAACATCAGTGTCTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015459.3-856s1c1
Sequence:CCGGCGTCTGGCAATGGATGAAATTCTCGAGAATTTCATCCATTGCCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015459.3-1743s1c1
Sequence:CCGGCATCAGGTATTCTGGTCAATACTCGAGTATTGACCAGAATACCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015459
VALIDATED
ATL3 MISSION shRNA Lentiviral Transduction Particles
atlastin GTPase 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015459.3-1100s1c1
Sequence:CCGGGCCCTGACTTTGATGGGAAATCTCGAGATTTCCCATCAAAGTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015459.3-1700s1c1
Sequence:CCGGGTATGGTTGGACTACTGTTAACTCGAGTTAACAGTAGTCCAACCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015459.3-379s1c1
Sequence:CCGGGATCAACATTCCTTTGAGCTACTCGAGTAGCTCAAAGGAATGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015459.3-1402s1c1
Sequence:CCGGCCTTATTTGTCTCCAGACATTCTCGAGAATGTCTGGAGACAAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015459.3-1816s1c1
Sequence:CCGGGCTTCTTCTCATATCGGTAATCTCGAGATTACCGATATGAGAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134997    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015459.3-1911s1c1
Sequence:CCGGCGTGAAGATCAAACAAGAACACTCGAGTGTTCTTGTTTGATCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015459.3-886s1c1
Sequence:CCGGCCTTTCCAGACACTGATGTTTCTCGAGAAACATCAGTGTCTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015459.3-856s1c1
Sequence:CCGGCGTCTGGCAATGGATGAAATTCTCGAGAATTTCATCCATTGCCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015459.3-1743s1c1
Sequence:CCGGCATCAGGTATTCTGGTCAATACTCGAGTATTGACCAGAATACCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146091
VALIDATED
ATL3 MISSION shRNA Bacterial Glycerol Stock
atlastin GTPase 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146091.2-2142s1c1
Sequence:CCGGGCCCACTGAAATGATGCTTTACTCGAGTAAAGCATCATTTCAGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146091.2-2144s1c1
Sequence:CCGGCCACTGAAATGATGCTTTATTCTCGAGAATAAAGCATCATTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146091.3-210s21c1
Sequence:CCGGTCTTGATGTGGTGGTAGTATCCTCGAGGATACTACCACCACATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146091.3-497s21c1
Sequence:CCGGTGAAGGATTGTGCTACCATTTCTCGAGAAATGGTAGCACAATCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146091.3-272s21c1
Sequence:CCGGACTTTATGCTGCGATACTTATCTCGAGATAAGTATCGCAGCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146091.3-1573s21c1
Sequence:CCGGGAGCAGGCTTCTTCGCATATTCTCGAGAATATGCGAAGAAGCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146091.3-2142s21c1
Sequence:CCGGGCCCACTGAAATGATGCTTTACTCGAGTAAAGCATCATTTCAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146091
VALIDATED
ATL3 MISSION shRNA shRNA Plasmid DNA
atlastin GTPase 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146091.2-2142s1c1
Sequence:CCGGGCCCACTGAAATGATGCTTTACTCGAGTAAAGCATCATTTCAGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146091.2-2144s1c1
Sequence:CCGGCCACTGAAATGATGCTTTATTCTCGAGAATAAAGCATCATTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146091.3-210s21c1
Sequence:CCGGTCTTGATGTGGTGGTAGTATCCTCGAGGATACTACCACCACATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146091.3-497s21c1
Sequence:CCGGTGAAGGATTGTGCTACCATTTCTCGAGAAATGGTAGCACAATCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146091.3-272s21c1
Sequence:CCGGACTTTATGCTGCGATACTTATCTCGAGATAAGTATCGCAGCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146091.3-1573s21c1
Sequence:CCGGGAGCAGGCTTCTTCGCATATTCTCGAGAATATGCGAAGAAGCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146091.3-2142s21c1
Sequence:CCGGGCCCACTGAAATGATGCTTTACTCGAGTAAAGCATCATTTCAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146091
VALIDATED
ATL3 MISSION shRNA Lentiviral Transduction Particles
atlastin GTPase 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146091.2-2142s1c1
Sequence:CCGGGCCCACTGAAATGATGCTTTACTCGAGTAAAGCATCATTTCAGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146091.2-2144s1c1
Sequence:CCGGCCACTGAAATGATGCTTTATTCTCGAGAATAAAGCATCATTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146091.3-210s21c1
Sequence:CCGGTCTTGATGTGGTGGTAGTATCCTCGAGGATACTACCACCACATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146091.3-497s21c1
Sequence:CCGGTGAAGGATTGTGCTACCATTTCTCGAGAAATGGTAGCACAATCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146091.3-272s21c1
Sequence:CCGGACTTTATGCTGCGATACTTATCTCGAGATAAGTATCGCAGCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146091.3-1573s21c1
Sequence:CCGGGAGCAGGCTTCTTCGCATATTCTCGAGAATATGCGAAGAAGCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146091.3-2142s21c1
Sequence:CCGGGCCCACTGAAATGATGCTTTACTCGAGTAAAGCATCATTTCAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027566
ATL3 MISSION shRNA Bacterial Glycerol Stock
atlastin GTPase 3
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000174957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027566.1-425s1c1
Sequence:CCGGGCTTTATTGTTGAGCCTTAAACTCGAGTTTAAGGCTCAACAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027566.1-418s1c1
Sequence:CCGGGCGGAAGGCTTTATTGTTGAGCTCGAGCTCAACAATAAAGCCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027566
ATL3 MISSION shRNA shRNA Plasmid DNA
atlastin GTPase 3
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000174957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027566.1-425s1c1
Sequence:CCGGGCTTTATTGTTGAGCCTTAAACTCGAGTTTAAGGCTCAACAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027566.1-418s1c1
Sequence:CCGGGCGGAAGGCTTTATTGTTGAGCTCGAGCTCAACAATAAAGCCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027566
ATL3 MISSION shRNA Lentiviral Transduction Particles
atlastin GTPase 3
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000174957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027566.1-425s1c1
Sequence:CCGGGCTTTATTGTTGAGCCTTAAACTCGAGTTTAAGGCTCAACAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027566.1-418s1c1
Sequence:CCGGGCGGAAGGCTTTATTGTTGAGCTCGAGCTCAACAATAAAGCCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks