EMAIL THIS PAGE TO A FRIEND

ATM

ataxia telangiectasia mutated

162 Gene Product Result for
Synonyms: AT1 ATA ATC ATD ATDC ATE TEL1 TELO1
Gene ID:
Human(472) Summary: The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
Mouse(11920) ataxia telangiectasia mutated homolog (human)
Rat(300711) ataxia telangiectasia mutated
Zebrafish(403064) ataxia telangiectasia mutated
cow(526824) ataxia telangiectasia mutated
Horse(100061765) ataxia telangiectasia mutated
domestic cat(101089291) ataxia telangiectasia mutated
dog(479450) ataxia telangiectasia mutated
chicken(395401) ataxia telangiectasia mutated
Thale Cress(823975) serine/threonine-protein kinase ATM
naked mole-rat(101718948) ataxia telangiectasia mutated
domestic guinea pig(100717983) ataxia telangiectasia mutated
sheep(101105847) ataxia telangiectasia mutated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500009 Anti-Androgen Receptor (C-term) antibody, Rabbit monoclonal clone SP224, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB4300417 Anti-ATM (Ab-1981) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
GW21178 Anti-ATM antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse
western blot pricing
SAB3500147 Anti-ATM antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501968 Anti-ATM antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry pricing
HPA067142 Anti-ATM antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
A6218 Anti-ATM antibody, Mouse monoclonal clone SYML6A10, purified from hybridoma cell culture human
immunocytochemistry, microarray, western blot pricing
A6093 Anti-ATM antibody, Mouse monoclonal clone SYR6D4, purified from hybridoma cell culture human
immunocytochemistry, immunoprecipitation, microarray, western blot pricing
SAB4300100 Anti-phospho-ATM (pSer1981) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
PLA0045 Goat anti-ATM Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, human
immunoprecipitation, proximity ligation assay, western blot pricing
SAB1402696 Monoclonal Anti-ATM antibody produced in mouse clone 2C10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
A1106 Monoclonal Anti-ATM antibody produced in mouse ~2 mg/mL, clone MAT3-4G10/8, purified immunoglobulin, PBS solution human, mouse
ELISA, immunoprecipitation, western blot pricing
PLA0086 Rabbit anti-ATM Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0424 AQUA Peptide YRPNDFSAFQCQ[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000051 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000051 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000051 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089521 MISSION® esiRNA esiRNA human ATM (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
05-513 Anti-ATM Antibody, clone AM9 200 µL, Detect ATM also known as Ataxia Telangiectasia Mutated with Anti-ATM Antibody, clone AM9 (Mouse Monoclonal Antibody), that has been demonstrated to work in WB. pricing
MAB3806 Anti-ATM phosphoSer1981 Antibody, clone 10H11.E12 100 µg, Anti-ATM Antibody, phosphoSer1981, clone 10H11.E12 is a Mouse Monoclonal Antibody for detection of ATM also known as Ataxia Telangiectasia Mutated & has been validated in IP, WB, ICC. pricing
05-740 Anti-phospho-ATM (Ser1981) Antibody, clone 10H11.E12 200 µg, Use Anti-phospho-ATM (Ser1981) Antibody, clone 10H11.E12 (Mouse Monoclonal Antibody) validated in ICC, IF, IP, WB to detect phospho-ATM (Ser1981) also known as A-T mutated. pricing
05-740-AF488 Anti-phospho-ATM (Ser1981) Antibody, clone 10H11.E12, Alexa Fluor® 488 100 µL, Anti-phospho-ATM (Ser1981) Antibody, clone 10H11.E12, Alexa Fluor® 488 is an antibody against phospho-ATM (Ser1981) for use in Immunocytochemistry. pricing
MAB3806-C Anti-phospho-ATM (Ser1981) Antibody, clone 10H11.E12, Ascites Free 100 μg, Anti-phospho-ATM (Ser1981) Antibody, clone 10H11.E12, Ascites Free is an antibody against phospho-ATM for use in Immunocytochemistry, Immunoprecipitation, ELISA, Western Blotting. pricing
FCMAB110P Anti-phospho-ATM (Ser1981) Antibody, clone 10H11.E12 PE conjugate 100 tests, Anti-phospho-ATM (Ser1981) Antibody, clone 10H11.E12 PE conjugate detects level of phospho-ATM (Ser1981) & has been published & validated for use in FC. pricing
14-933-M ATM, active 10 µg pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000051 siRNAs that have been validated in the lab human pricing
NM_138292 Rosetta Predictions human pricing
NM_001106821 Rosetta Predictions rat pricing
NM_007499 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000051 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093615 validated 8463
2 SASI_Hs01_00093616 predicted 6463
3 SASI_Hs01_00093617 predicted 6460
4 SASI_Hs02_00301751 predicted 7936
5 SASI_Hs01_00093620 predicted 5302
6 SASI_Hs02_00301752 predicted 5382
7 SASI_Hs01_00093621 predicted 6967
8 SASI_Hs01_00093622 predicted 7044
9 SASI_Hs02_00301753 predicted 8158
10 SASI_Hs02_00301754 predicted 8018
11 SASI_Hs02_00301755 predicted 5295
12 SASI_Hs01_00093614 predicted 4779
13 SASI_Hs01_00093618 predicted 8940
14 SASI_Hs01_00093619 predicted 7304
15 SASI_Hs01_00093623 predicted 8264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028583 predicted 2298
2 SASI_Hs01_00028584 predicted 2284
3 SASI_Hs02_00363381 predicted 3770
4 SASI_Hs01_00028586 predicted 1135
5 SASI_Hs02_00363382 predicted 1207
6 SASI_Hs01_00028588 predicted 2797
7 SASI_Hs01_00028589 predicted 2871
8 SASI_Hs02_00363383 predicted 3986
9 SASI_Hs02_00363384 predicted 3844
10 SASI_Hs02_00363385 predicted 1125
11 SASI_Hs01_00028581 predicted 611
12 SASI_Hs01_00028582 predicted 4287
13 SASI_Hs01_00028585 predicted 4766
14 SASI_Hs01_00028587 predicted 2045
15 SASI_Hs01_00028590 predicted 4095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106821 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222738 predicted 8981
2 SASI_Rn02_00222739 predicted 1580
3 SASI_Rn02_00222740 predicted 615
4 SASI_Rn02_00222741 predicted 2999
5 SASI_Rn02_00222742 predicted 6106
6 SASI_Rn02_00222743 predicted 6191
7 SASI_Rn02_00222744 predicted 8216
8 SASI_Rn02_00222745 predicted 1679
9 SASI_Rn02_00222746 predicted 1453
10 SASI_Rn02_00222747 predicted 8115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065839 predicted 526
2 SASI_Mm01_00065840 predicted 1660
3 SASI_Mm01_00065842 predicted 6663
4 SASI_Mm02_00311774 predicted 5127
5 SASI_Mm01_00065843 predicted 1599
6 SASI_Mm01_00065845 predicted 917
7 SASI_Mm01_00065846 predicted 4136
8 SASI_Mm01_00065848 predicted 2311
9 SASI_Mm02_00311775 predicted 4712
10 SASI_Mm02_00311776 predicted 6515
11 SASI_Mm01_00065841 predicted 1826
12 SASI_Mm01_00065844 predicted 2797
13 SASI_Mm01_00065847 predicted 6003
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007499
VALIDATED
ATM MISSION shRNA Bacterial Glycerol Stock
ataxia telangiectasia mutated
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007499.2-1375s21c1
Sequence:CCGGACAGATTACAACCCGATTAATCTCGAGATTAATCGGGTTGTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007499.2-4635s21c1
Sequence:CCGGCCCTTTGCTGTGACCTATTAACTCGAGTTAATAGGTCACAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007499.2-8240s21c1
Sequence:CCGGCGCTTAGCTGGAGGCTTAAATCTCGAGATTTAAGCCTCCAGCTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007499.2-6245s21c1
Sequence:CCGGCTTACTAGAATACGGACATATCTCGAGATATGTCCGTATTCTAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007499.2-1602s21c1
Sequence:CCGGCTATTACCTTTCGTGGTATAACTCGAGTTATACCACGAAAGGTAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007499.1-9283s1c1
Sequence:CCGGCCACCATATTTGGACAGGAATCTCGAGATTCCTGTCCAAATATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007499.1-1824s1c1
Sequence:CCGGCCTCCAATTCTTCAGCGTAATCTCGAGATTACGCTGAAGAATTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007499.1-1129s1c1
Sequence:CCGGCCGTGGAGATTTCTCAATCTTCTCGAGAAGATTGAGAAATCTCCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007499.1-8872s1c1
Sequence:CCGGCGATGGAAGTTATGCGGAGTTCTCGAGAACTCCGCATAACTTCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007499
VALIDATED
ATM MISSION shRNA shRNA Plasmid DNA
ataxia telangiectasia mutated
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007499.2-1375s21c1
Sequence:CCGGACAGATTACAACCCGATTAATCTCGAGATTAATCGGGTTGTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007499.2-4635s21c1
Sequence:CCGGCCCTTTGCTGTGACCTATTAACTCGAGTTAATAGGTCACAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007499.2-8240s21c1
Sequence:CCGGCGCTTAGCTGGAGGCTTAAATCTCGAGATTTAAGCCTCCAGCTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007499.2-6245s21c1
Sequence:CCGGCTTACTAGAATACGGACATATCTCGAGATATGTCCGTATTCTAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007499.2-1602s21c1
Sequence:CCGGCTATTACCTTTCGTGGTATAACTCGAGTTATACCACGAAAGGTAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007499.1-9283s1c1
Sequence:CCGGCCACCATATTTGGACAGGAATCTCGAGATTCCTGTCCAAATATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007499.1-1824s1c1
Sequence:CCGGCCTCCAATTCTTCAGCGTAATCTCGAGATTACGCTGAAGAATTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007499.1-1129s1c1
Sequence:CCGGCCGTGGAGATTTCTCAATCTTCTCGAGAAGATTGAGAAATCTCCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007499.1-8872s1c1
Sequence:CCGGCGATGGAAGTTATGCGGAGTTCTCGAGAACTCCGCATAACTTCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007499
VALIDATED
ATM MISSION shRNA Lentiviral Transduction Particles
ataxia telangiectasia mutated
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007499.2-1375s21c1
Sequence:CCGGACAGATTACAACCCGATTAATCTCGAGATTAATCGGGTTGTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007499.2-4635s21c1
Sequence:CCGGCCCTTTGCTGTGACCTATTAACTCGAGTTAATAGGTCACAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007499.2-8240s21c1
Sequence:CCGGCGCTTAGCTGGAGGCTTAAATCTCGAGATTTAAGCCTCCAGCTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007499.2-6245s21c1
Sequence:CCGGCTTACTAGAATACGGACATATCTCGAGATATGTCCGTATTCTAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007499.2-1602s21c1
Sequence:CCGGCTATTACCTTTCGTGGTATAACTCGAGTTATACCACGAAAGGTAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007499.1-9283s1c1
Sequence:CCGGCCACCATATTTGGACAGGAATCTCGAGATTCCTGTCCAAATATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007499.1-1824s1c1
Sequence:CCGGCCTCCAATTCTTCAGCGTAATCTCGAGATTACGCTGAAGAATTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007499.1-1129s1c1
Sequence:CCGGCCGTGGAGATTTCTCAATCTTCTCGAGAAGATTGAGAAATCTCCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007499.1-8872s1c1
Sequence:CCGGCGATGGAAGTTATGCGGAGTTCTCGAGAACTCCGCATAACTTCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000051
VALIDATED
ATM MISSION shRNA Bacterial Glycerol Stock
ataxia telangiectasia mutated
Human
24 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000051.3-420s21c1
Sequence:CCGGGCCGTCAACTAGAACATGATACTCGAGTATCATGTTCTAGTTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000051.3-684s21c1
Sequence:CCGGTGGTCAAATACTTCATCAAATCTCGAGATTTGATGAAGTATTTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000051.3-9548s21c1
Sequence:CCGGTGGGTGTGATCTTCAGTATATCTCGAGATATACTGAAGATCACACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000051.3-488s21c1
Sequence:CCGGCGAGATCCTGAAACAATTAAACTCGAGTTTAATTGTTTCAGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000051.3-11568s21c1
Sequence:CCGGTCGTGTATTAGTGAGTATAATCTCGAGATTATACTCACTAATACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000051.3-12465s1c1
Sequence:CCGGGCTAAGTCACTGACCCATATTCTCGAGAATATGGGTCAGTGACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000051.3-4332s1c1
Sequence:CCGGCCAAGGTCTATGATATGCTTACTCGAGTAAGCATATCATAGACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.3-2794s1c1
Sequence:CCGGCCTGCGATTGTTAACATCAAACTCGAGTTTGATGTTAACAATCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194816    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000051.3-12839s1c1
Sequence:CCGGCACAAACTCTTGGTCATTATACTCGAGTATAATGACCAAGAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000051.3-9358s1c1
Sequence:CCGGCAAACGAAATCTCAGTGATATCTCGAGATATCACTGAGATTTCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.3-6606s1c1
Sequence:CCGGGCCATATTCTTTCCGTCTATTCTCGAGAATAGACGGAAAGAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000051.3-1851s1c1
Sequence:CCGGGTATTACCTTTCGTGGTATAACTCGAGTTATACCACGAAAGGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000051.3-12787s1c1
Sequence:CCGGCCTACTTTGTGCAGGTCATACCTCGAGGTATGACCTGCACAAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000051.3-8423s1c1
Sequence:CCGGCTGGTGACTATACAGTCATTTCTCGAGAAATGACTGTATAGTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000051.2-9380s1c1
Sequence:CCGGCCTTTCATTCAGCCTTTAGAACTCGAGTTCTAAAGGCTGAATGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-2990s1c1
Sequence:CCGGGCACGCTAGAACCTACCAAATCTCGAGATTTGGTAGGTTCTAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-3610s1c1
Sequence:CCGGCCTGAAACTTTGGATGAAATTCTCGAGAATTTCATCCAAAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-751s1c1
Sequence:CCGGGCTAGAATAATTCATGCTGTTCTCGAGAACAGCATGAATTATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-1717s1c1
Sequence:CCGGGCCATAATTCAGGGTAGTTTACTCGAGTAAACTACCCTGAATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-224s1c1
Sequence:CCGGGCCGTCAACTAGAACATGATACTCGAGTATCATGTTCTAGTTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000051.2-9426s1c1
Sequence:CCGGCCTGCCAACATACTTTAAGTACTCGAGTACTTAAAGTATGTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-9211s1c1
Sequence:CCGGCGTGTCTTAATGAGACTACAACTCGAGTTGTAGTCTCATTAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000051.2-1974s1c1
Sequence:CCGGGCCTCCAATTCTTCACAGTAACTCGAGTTACTGTGAAGAATTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000051.x-9530s1c1
Sequence:CCGGTGATGGTCTTAAGGAACATCTCTCGAGAGATGTTCCTTAAGACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000051
VALIDATED
ATM MISSION shRNA shRNA Plasmid DNA
ataxia telangiectasia mutated
Human
24 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000051.3-420s21c1
Sequence:CCGGGCCGTCAACTAGAACATGATACTCGAGTATCATGTTCTAGTTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000051.3-684s21c1
Sequence:CCGGTGGTCAAATACTTCATCAAATCTCGAGATTTGATGAAGTATTTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000051.3-9548s21c1
Sequence:CCGGTGGGTGTGATCTTCAGTATATCTCGAGATATACTGAAGATCACACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000051.3-488s21c1
Sequence:CCGGCGAGATCCTGAAACAATTAAACTCGAGTTTAATTGTTTCAGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000051.3-11568s21c1
Sequence:CCGGTCGTGTATTAGTGAGTATAATCTCGAGATTATACTCACTAATACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000051.3-12465s1c1
Sequence:CCGGGCTAAGTCACTGACCCATATTCTCGAGAATATGGGTCAGTGACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000051.3-4332s1c1
Sequence:CCGGCCAAGGTCTATGATATGCTTACTCGAGTAAGCATATCATAGACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.3-2794s1c1
Sequence:CCGGCCTGCGATTGTTAACATCAAACTCGAGTTTGATGTTAACAATCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194816    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000051.3-12839s1c1
Sequence:CCGGCACAAACTCTTGGTCATTATACTCGAGTATAATGACCAAGAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000051.3-9358s1c1
Sequence:CCGGCAAACGAAATCTCAGTGATATCTCGAGATATCACTGAGATTTCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.3-6606s1c1
Sequence:CCGGGCCATATTCTTTCCGTCTATTCTCGAGAATAGACGGAAAGAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000051.3-1851s1c1
Sequence:CCGGGTATTACCTTTCGTGGTATAACTCGAGTTATACCACGAAAGGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000051.3-12787s1c1
Sequence:CCGGCCTACTTTGTGCAGGTCATACCTCGAGGTATGACCTGCACAAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000051.3-8423s1c1
Sequence:CCGGCTGGTGACTATACAGTCATTTCTCGAGAAATGACTGTATAGTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000051.2-9380s1c1
Sequence:CCGGCCTTTCATTCAGCCTTTAGAACTCGAGTTCTAAAGGCTGAATGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-2990s1c1
Sequence:CCGGGCACGCTAGAACCTACCAAATCTCGAGATTTGGTAGGTTCTAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-3610s1c1
Sequence:CCGGCCTGAAACTTTGGATGAAATTCTCGAGAATTTCATCCAAAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-751s1c1
Sequence:CCGGGCTAGAATAATTCATGCTGTTCTCGAGAACAGCATGAATTATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-1717s1c1
Sequence:CCGGGCCATAATTCAGGGTAGTTTACTCGAGTAAACTACCCTGAATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-224s1c1
Sequence:CCGGGCCGTCAACTAGAACATGATACTCGAGTATCATGTTCTAGTTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000051.2-9426s1c1
Sequence:CCGGCCTGCCAACATACTTTAAGTACTCGAGTACTTAAAGTATGTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-9211s1c1
Sequence:CCGGCGTGTCTTAATGAGACTACAACTCGAGTTGTAGTCTCATTAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000051.2-1974s1c1
Sequence:CCGGGCCTCCAATTCTTCACAGTAACTCGAGTTACTGTGAAGAATTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000051.x-9530s1c1
Sequence:CCGGTGATGGTCTTAAGGAACATCTCTCGAGAGATGTTCCTTAAGACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000051
VALIDATED
ATM MISSION shRNA Lentiviral Transduction Particles
ataxia telangiectasia mutated
Human
24 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000051.3-420s21c1
Sequence:CCGGGCCGTCAACTAGAACATGATACTCGAGTATCATGTTCTAGTTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000051.3-684s21c1
Sequence:CCGGTGGTCAAATACTTCATCAAATCTCGAGATTTGATGAAGTATTTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000051.3-9548s21c1
Sequence:CCGGTGGGTGTGATCTTCAGTATATCTCGAGATATACTGAAGATCACACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000051.3-488s21c1
Sequence:CCGGCGAGATCCTGAAACAATTAAACTCGAGTTTAATTGTTTCAGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000051.3-11568s21c1
Sequence:CCGGTCGTGTATTAGTGAGTATAATCTCGAGATTATACTCACTAATACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000051.3-12465s1c1
Sequence:CCGGGCTAAGTCACTGACCCATATTCTCGAGAATATGGGTCAGTGACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000051.3-4332s1c1
Sequence:CCGGCCAAGGTCTATGATATGCTTACTCGAGTAAGCATATCATAGACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.3-2794s1c1
Sequence:CCGGCCTGCGATTGTTAACATCAAACTCGAGTTTGATGTTAACAATCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194816    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000051.3-12839s1c1
Sequence:CCGGCACAAACTCTTGGTCATTATACTCGAGTATAATGACCAAGAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000051.3-9358s1c1
Sequence:CCGGCAAACGAAATCTCAGTGATATCTCGAGATATCACTGAGATTTCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.3-6606s1c1
Sequence:CCGGGCCATATTCTTTCCGTCTATTCTCGAGAATAGACGGAAAGAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000051.3-1851s1c1
Sequence:CCGGGTATTACCTTTCGTGGTATAACTCGAGTTATACCACGAAAGGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000051.3-12787s1c1
Sequence:CCGGCCTACTTTGTGCAGGTCATACCTCGAGGTATGACCTGCACAAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000051.3-8423s1c1
Sequence:CCGGCTGGTGACTATACAGTCATTTCTCGAGAAATGACTGTATAGTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000051.2-9380s1c1
Sequence:CCGGCCTTTCATTCAGCCTTTAGAACTCGAGTTCTAAAGGCTGAATGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-2990s1c1
Sequence:CCGGGCACGCTAGAACCTACCAAATCTCGAGATTTGGTAGGTTCTAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-3610s1c1
Sequence:CCGGCCTGAAACTTTGGATGAAATTCTCGAGAATTTCATCCAAAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-751s1c1
Sequence:CCGGGCTAGAATAATTCATGCTGTTCTCGAGAACAGCATGAATTATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-1717s1c1
Sequence:CCGGGCCATAATTCAGGGTAGTTTACTCGAGTAAACTACCCTGAATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-224s1c1
Sequence:CCGGGCCGTCAACTAGAACATGATACTCGAGTATCATGTTCTAGTTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000051.2-9426s1c1
Sequence:CCGGCCTGCCAACATACTTTAAGTACTCGAGTACTTAAAGTATGTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000051.2-9211s1c1
Sequence:CCGGCGTGTCTTAATGAGACTACAACTCGAGTTGTAGTCTCATTAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000051.2-1974s1c1
Sequence:CCGGGCCTCCAATTCTTCACAGTAACTCGAGTTACTGTGAAGAATTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000051.x-9530s1c1
Sequence:CCGGTGATGGTCTTAAGGAACATCTCTCGAGAGATGTTCCTTAAGACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks