EMAIL THIS PAGE TO A FRIEND

ATN1

atrophin 1

89 Gene Product Result for
Synonyms: B37 D12S755E DRPLA HRS NOD
UniProtKB ID: P54259, Q99495, Q99621, Q9UEK7
Gene ID:
Human(1822) Summary: Dentatorubral pallidoluysian atrophy (DRPLA) is a rare neurodegenerative disorder characterized by cerebellar ataxia, myoclonic epilepsy, choreoathetosis, and dementia. The disorder is related to the expansion from 7-23 copies to 49-75 copies of a trinucleotide repeat (CAG/CAA) within this gene. The encoded protein includes a serine repeat and a region of alternating acidic and basic amino acids, as well as the variable glutamine repeat. Alternative splicing results in two transcripts variants that encode the same protein. [provided by RefSeq, Feb 2010]
Mouse(13498) atrophin 1
Rat(29515) atrophin 1
Zebrafish(321707) atrophin 1
cow(513125) atrophin 1
dog(611607) atrophin 1
Thale Cress(822378) putative serine/threonine/tyrosine kinase ATN1
chicken(427946) atrophin 1
sheep(101108302) atrophin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007881 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007881 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007881 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001940 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001940 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001940 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007026 Rosetta Predictions human pricing
NM_001940 Rosetta Predictions human pricing
NM_017228 Rosetta Predictions rat pricing
NM_007881 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073391 predicted 1084
2 SASI_Hs01_00073392 predicted 511
3 SASI_Hs01_00073393 predicted 3817
4 SASI_Hs01_00073394 predicted 447
5 SASI_Hs01_00073395 predicted 3419
6 SASI_Hs01_00073396 predicted 2984
7 SASI_Hs01_00073397 predicted 3075
8 SASI_Hs01_00073398 predicted 2053
9 SASI_Hs01_00073399 predicted 3069
10 SASI_Hs01_00073400 predicted 3298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133124 predicted 1077
2 SASI_Hs01_00133125 predicted 506
3 SASI_Hs01_00133126 predicted 3814
4 SASI_Hs01_00133127 predicted 435
5 SASI_Hs01_00133128 predicted 3413
6 SASI_Hs01_00133129 predicted 2973
7 SASI_Hs01_00133130 predicted 3073
8 SASI_Hs01_00133131 predicted 3059
9 SASI_Hs01_00133132 predicted 3296
10 SASI_Hs01_00133133 predicted 3788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074056 predicted 3845
2 SASI_Rn01_00074057 predicted 1431
3 SASI_Rn01_00074058 predicted 323
4 SASI_Rn01_00074059 predicted 1164
5 SASI_Rn02_00261596 predicted 3862
6 SASI_Rn01_00074060 predicted 472
7 SASI_Rn01_00074061 predicted 2031
8 SASI_Rn01_00074062 predicted 714
9 SASI_Rn01_00074064 predicted 3691
10 SASI_Rn01_00074063 predicted 627
11 SASI_Rn01_00074065 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069169 predicted 1579
2 SASI_Mm01_00069170 predicted 3628
3 SASI_Mm01_00069171 predicted 651
4 SASI_Mm01_00069172 predicted 1002
5 SASI_Mm01_00069173 predicted 1194
6 SASI_Mm01_00069174 predicted 884
7 SASI_Mm01_00069175 predicted 345
8 SASI_Mm01_00069176 predicted 1854
9 SASI_Mm01_00069177 predicted 1786
10 SASI_Mm02_00312666 predicted 2027
11 SASI_Mm01_00069168 predicted 3771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007881
VALIDATED
ATN1 MISSION shRNA Bacterial Glycerol Stock
atrophin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007881.4-4171s1c1
Sequence:CCGGCCTAACCCATTGGTGTGATTTCTCGAGAAATCACACCAATGGGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007881.4-1552s1c1
Sequence:CCGGGCCCAGTTATCCTCATTCCTTCTCGAGAAGGAATGAGGATAACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007881.4-2025s1c1
Sequence:CCGGCTTCCTCTCAAGCCTCCTATTCTCGAGAATAGGAGGCTTGAGAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007881.4-1450s1c1
Sequence:CCGGGCCTCCAATGCGATATCCATACTCGAGTATGGATATCGCATTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007881.4-3617s1c1
Sequence:CCGGCTGCACGAGAACGAAGTTCTTCTCGAGAAGAACTTCGTTCTCGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007881
VALIDATED
ATN1 MISSION shRNA shRNA Plasmid DNA
atrophin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007881.4-4171s1c1
Sequence:CCGGCCTAACCCATTGGTGTGATTTCTCGAGAAATCACACCAATGGGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007881.4-1552s1c1
Sequence:CCGGGCCCAGTTATCCTCATTCCTTCTCGAGAAGGAATGAGGATAACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007881.4-2025s1c1
Sequence:CCGGCTTCCTCTCAAGCCTCCTATTCTCGAGAATAGGAGGCTTGAGAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007881.4-1450s1c1
Sequence:CCGGGCCTCCAATGCGATATCCATACTCGAGTATGGATATCGCATTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007881.4-3617s1c1
Sequence:CCGGCTGCACGAGAACGAAGTTCTTCTCGAGAAGAACTTCGTTCTCGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007881
VALIDATED
ATN1 MISSION shRNA Lentiviral Transduction Particles
atrophin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007881.4-4171s1c1
Sequence:CCGGCCTAACCCATTGGTGTGATTTCTCGAGAAATCACACCAATGGGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007881.4-1552s1c1
Sequence:CCGGGCCCAGTTATCCTCATTCCTTCTCGAGAAGGAATGAGGATAACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007881.4-2025s1c1
Sequence:CCGGCTTCCTCTCAAGCCTCCTATTCTCGAGAATAGGAGGCTTGAGAGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007881.4-1450s1c1
Sequence:CCGGGCCTCCAATGCGATATCCATACTCGAGTATGGATATCGCATTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007881.4-3617s1c1
Sequence:CCGGCTGCACGAGAACGAAGTTCTTCTCGAGAAGAACTTCGTTCTCGTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001940
VALIDATED
ATN1 MISSION shRNA Bacterial Glycerol Stock
atrophin 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001940.3-4120s1c1
Sequence:CCGGCCGTTGGTGTGATTATTTCATCTCGAGATGAAATAATCACACCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001940.3-2478s1c1
Sequence:CCGGCCTCCCAAGGTGGTAGATGTACTCGAGTACATCTACCACCTTGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001940.3-2064s1c1
Sequence:CCGGGCTACCCTTTCCACGGTCATTCTCGAGAATGACCGTGGAAAGGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001940.3-3567s1c1
Sequence:CCGGGTTCTTCGTCACCAGCTCTTTCTCGAGAAAGAGCTGGTGACGAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001940.3-1339s1c1
Sequence:CCGGCCATGAGGTTTCCTTATTCATCTCGAGATGAATAAGGAAACCTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001940
VALIDATED
ATN1 MISSION shRNA shRNA Plasmid DNA
atrophin 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001940.3-4120s1c1
Sequence:CCGGCCGTTGGTGTGATTATTTCATCTCGAGATGAAATAATCACACCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001940.3-2478s1c1
Sequence:CCGGCCTCCCAAGGTGGTAGATGTACTCGAGTACATCTACCACCTTGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001940.3-2064s1c1
Sequence:CCGGGCTACCCTTTCCACGGTCATTCTCGAGAATGACCGTGGAAAGGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001940.3-3567s1c1
Sequence:CCGGGTTCTTCGTCACCAGCTCTTTCTCGAGAAAGAGCTGGTGACGAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001940.3-1339s1c1
Sequence:CCGGCCATGAGGTTTCCTTATTCATCTCGAGATGAATAAGGAAACCTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001940
VALIDATED
ATN1 MISSION shRNA Lentiviral Transduction Particles
atrophin 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001940.3-4120s1c1
Sequence:CCGGCCGTTGGTGTGATTATTTCATCTCGAGATGAAATAATCACACCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001940.3-2478s1c1
Sequence:CCGGCCTCCCAAGGTGGTAGATGTACTCGAGTACATCTACCACCTTGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001940.3-2064s1c1
Sequence:CCGGGCTACCCTTTCCACGGTCATTCTCGAGAATGACCGTGGAAAGGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001940.3-3567s1c1
Sequence:CCGGGTTCTTCGTCACCAGCTCTTTCTCGAGAAAGAGCTGGTGACGAAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001940.3-1339s1c1
Sequence:CCGGCCATGAGGTTTCCTTATTCATCTCGAGATGAATAAGGAAACCTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)