EMAIL THIS PAGE TO A FRIEND

ATOH1

atonal homolog 1 (Drosophila)

62 Gene Product Result for
Synonyms: ATH1 HATH1 MATH-1 bHLHa14
UniProtKB ID: Q92858, Q14CT9
Gene ID:
Human(474) Summary: This protein belongs to the basic helix-loop-helix (BHLH) family of transcription factors. It activates E-box dependent transcription along with E47. [provided by RefSeq, Jul 2008]
Mouse(11921) atonal homolog 1 (Drosophila)
Rat(500156) atonal homolog 1 (Drosophila)
chicken(428742) atonal homolog 1 (Drosophila)
chicken(101750213) atonal homolog 1 (Drosophila)
chicken(101665953) atonal homolog 1 (Drosophila)
dog(487864) atonal homolog 1 (Drosophila)
cow(539158) atonal homolog 1 (Drosophila)
domestic cat(101084359) atonal homolog 1 (Drosophila)
sheep(101103067) atonal homolog 1 (Drosophila)
naked mole-rat(101703014) atonal homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A7860 Anti-ATOH1 (16-28) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A7985 Anti-ATOH1 (326-340) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405497 Anti-ATOH1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1412011 ANTI-ATOH1 antibody produced in mouse clone 1F3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412012 ANTI-ATOH1 antibody produced in mouse clone 3E2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412013 ANTI-ATOH1 antibody produced in mouse clone 3B12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412014 ANTI-ATOH1 antibody produced in mouse clone 2G8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412015 ANTI-ATOH1 antibody produced in mouse clone 2A12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412016 ANTI-ATOH1 antibody produced in mouse clone 4H2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412585 ANTI-ATOH1 antibody produced in mouse clone 4D10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412586 ANTI-ATOH1 antibody produced in mouse clone 1A8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412587 ANTI-ATOH1 antibody produced in mouse clone 2B1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412588 ANTI-ATOH1 antibody produced in mouse clone 2B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2108092 Anti-ATOH1 antibody produced in rabbit affinity isolated antibody mouse, bovine, horse, canine, rat, human, rabbit
immunohistochemistry, western blot pricing
SAB2100177 Anti-ATOH1 antibody produced in rabbit affinity isolated antibody, lyophilized powder horse, canine, mouse, bovine, human, rat, rabbit
western blot pricing
SAB1305983 ANTI-MATH1/HATH1/ATOH1(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1305982 ANTI-MATH1/HATH1/ATOH1(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
WH0000474M1 Monoclonal Anti-ATOH1 antibody produced in mouse clone 1B12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403584 Monoclonal Anti-ATOH1, (C-terminal) antibody produced in mouse clone 1C5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005172 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU002271 MISSION® esiRNA esiRNA targeting mouse Atoh1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005172 Rosetta Predictions human pricing
NM_001109238 Rosetta Predictions rat pricing
NM_007500 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221712 predicted 565
2 SASI_Hs01_00221713 predicted 525
3 SASI_Hs02_00339120 predicted 366
4 SASI_Hs01_00221714 predicted 538
5 SASI_Hs01_00221715 predicted 529
6 SASI_Hs01_00221716 predicted 223
7 SASI_Hs02_00339121 predicted 624
8 SASI_Hs01_00221718 predicted 601
9 SASI_Hs01_00221719 predicted 545
10 SASI_Hs01_00221720 predicted 507
11 SASI_Hs01_00221717 predicted 606
12 SASI_Hs01_00221721 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109238 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246444 predicted 1513
2 SASI_Rn02_00246445 predicted 555
3 SASI_Rn02_00246446 predicted 1691
4 SASI_Rn02_00246447 predicted 760
5 SASI_Rn02_00246448 predicted 1650
6 SASI_Rn02_00246449 predicted 1596
7 SASI_Rn02_00246450 predicted 335
8 SASI_Rn02_00246451 predicted 544
9 SASI_Rn02_00246452 predicted 737
10 SASI_Rn02_00246453 predicted 1729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108932 predicted 1574
2 SASI_Mm01_00108933 predicted 1568
3 SASI_Mm01_00108934 predicted 476
4 SASI_Mm01_00108935 predicted 760
5 SASI_Mm01_00108936 predicted 1438
6 SASI_Mm01_00108937 predicted 301
7 SASI_Mm01_00108939 predicted 1488
8 SASI_Mm01_00108940 predicted 1554
9 SASI_Mm01_00108941 predicted 1168
10 SASI_Mm02_00311777 predicted 1424
11 SASI_Mm01_00108938 predicted 344
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005172
ATOH1 MISSION shRNA Bacterial Glycerol Stock
atonal homolog 1 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005172.1-230s1c1
Sequence:CCGGCCGCCCAGTATTTGCTACATTCTCGAGAATGTAGCAAATACTGGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005172.1-870s1c1
Sequence:CCGGCGCTCTGCACTTCTCGACTTTCTCGAGAAAGTCGAGAAGTGCAGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005172.1-546s1c1
Sequence:CCGGGCGCAATGTTATCCCGTCGTTCTCGAGAACGACGGGATAACATTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005172.1-441s1c1
Sequence:CCGGCCCTTCCAGCAAACAGGTGAACTCGAGTTCACCTGTTTGCTGGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005172.1-365s21c1
Sequence:CCGGTGAAAGTGCGGGAACAGCTGTCTCGAGACAGCTGTTCCCGCACTTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005172.1-579s21c1
Sequence:CCGGGAAGCTGTCCAAATATGAGACCTCGAGGTCTCATATTTGGACAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005172.1-811s21c1
Sequence:CCGGAGTTGCCGGACTCGCTTCTCACTCGAGTGAGAAGCGAGTCCGGCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005172.1-114s21c1
Sequence:CCGGTGCAACTTTGCAGGCGAGAGACTCGAGTCTCTCGCCTGCAAAGTTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005172
ATOH1 MISSION shRNA shRNA Plasmid DNA
atonal homolog 1 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005172.1-230s1c1
Sequence:CCGGCCGCCCAGTATTTGCTACATTCTCGAGAATGTAGCAAATACTGGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005172.1-870s1c1
Sequence:CCGGCGCTCTGCACTTCTCGACTTTCTCGAGAAAGTCGAGAAGTGCAGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005172.1-546s1c1
Sequence:CCGGGCGCAATGTTATCCCGTCGTTCTCGAGAACGACGGGATAACATTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005172.1-441s1c1
Sequence:CCGGCCCTTCCAGCAAACAGGTGAACTCGAGTTCACCTGTTTGCTGGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005172.1-365s21c1
Sequence:CCGGTGAAAGTGCGGGAACAGCTGTCTCGAGACAGCTGTTCCCGCACTTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005172.1-579s21c1
Sequence:CCGGGAAGCTGTCCAAATATGAGACCTCGAGGTCTCATATTTGGACAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005172.1-811s21c1
Sequence:CCGGAGTTGCCGGACTCGCTTCTCACTCGAGTGAGAAGCGAGTCCGGCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005172.1-114s21c1
Sequence:CCGGTGCAACTTTGCAGGCGAGAGACTCGAGTCTCTCGCCTGCAAAGTTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005172
ATOH1 MISSION shRNA Lentiviral Transduction Particles
atonal homolog 1 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005172.1-230s1c1
Sequence:CCGGCCGCCCAGTATTTGCTACATTCTCGAGAATGTAGCAAATACTGGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005172.1-870s1c1
Sequence:CCGGCGCTCTGCACTTCTCGACTTTCTCGAGAAAGTCGAGAAGTGCAGAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005172.1-546s1c1
Sequence:CCGGGCGCAATGTTATCCCGTCGTTCTCGAGAACGACGGGATAACATTGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005172.1-441s1c1
Sequence:CCGGCCCTTCCAGCAAACAGGTGAACTCGAGTTCACCTGTTTGCTGGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005172.1-365s21c1
Sequence:CCGGTGAAAGTGCGGGAACAGCTGTCTCGAGACAGCTGTTCCCGCACTTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005172.1-579s21c1
Sequence:CCGGGAAGCTGTCCAAATATGAGACCTCGAGGTCTCATATTTGGACAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005172.1-811s21c1
Sequence:CCGGAGTTGCCGGACTCGCTTCTCACTCGAGTGAGAAGCGAGTCCGGCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005172.1-114s21c1
Sequence:CCGGTGCAACTTTGCAGGCGAGAGACTCGAGTCTCTCGCCTGCAAAGTTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007500
ATOH1 MISSION shRNA Bacterial Glycerol Stock
atonal homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007500.2-1749s1c1
Sequence:CCGGCCCAGAATACACGCACTTCATCTCGAGATGAAGTGCGTGTATTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007500.2-769s1c1
Sequence:CCGGCTGTCCAAATATGAGACCCTACTCGAGTAGGGTCTCATATTTGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007500.2-744s1c1
Sequence:CCGGCCCGTCCTTCAACAACGACAACTCGAGTTGTCGTTGTTGAAGGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007500.2-1189s1c1
Sequence:CCGGCACAGAAGTGACGGAGAGTTTCTCGAGAAACTCTCCGTCACTTCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007500.2-419s1c1
Sequence:CCGGCCGCCCAGTATCTGCTGCATTCTCGAGAATGCAGCAGATACTGGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007500.4-716s21c1
Sequence:CCGGGCAACGTTATCCCGTCCTTCACTCGAGTGAAGGACGGGATAACGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007500.4-1631s21c1
Sequence:CCGGCTTTACTGAACACGGACTATTCTCGAGAATAGTCCGTGTTCAGTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007500.4-806s21c1
Sequence:CCGGAGTTGCTGCAGACTCCCAATGCTCGAGCATTGGGAGTCTGCAGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007500.4-772s21c1
Sequence:CCGGCAGATGGCCCAGATCTACATCCTCGAGGATGTAGATCTGGGCCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007500.4-743s21c1
Sequence:CCGGACAAGAAGCTGTCCAAATATGCTCGAGCATATTTGGACAGCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007500
ATOH1 MISSION shRNA shRNA Plasmid DNA
atonal homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007500.2-1749s1c1
Sequence:CCGGCCCAGAATACACGCACTTCATCTCGAGATGAAGTGCGTGTATTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007500.2-769s1c1
Sequence:CCGGCTGTCCAAATATGAGACCCTACTCGAGTAGGGTCTCATATTTGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007500.2-744s1c1
Sequence:CCGGCCCGTCCTTCAACAACGACAACTCGAGTTGTCGTTGTTGAAGGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007500.2-1189s1c1
Sequence:CCGGCACAGAAGTGACGGAGAGTTTCTCGAGAAACTCTCCGTCACTTCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007500.2-419s1c1
Sequence:CCGGCCGCCCAGTATCTGCTGCATTCTCGAGAATGCAGCAGATACTGGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007500.4-716s21c1
Sequence:CCGGGCAACGTTATCCCGTCCTTCACTCGAGTGAAGGACGGGATAACGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007500.4-1631s21c1
Sequence:CCGGCTTTACTGAACACGGACTATTCTCGAGAATAGTCCGTGTTCAGTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007500.4-806s21c1
Sequence:CCGGAGTTGCTGCAGACTCCCAATGCTCGAGCATTGGGAGTCTGCAGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007500.4-772s21c1
Sequence:CCGGCAGATGGCCCAGATCTACATCCTCGAGGATGTAGATCTGGGCCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007500.4-743s21c1
Sequence:CCGGACAAGAAGCTGTCCAAATATGCTCGAGCATATTTGGACAGCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007500
ATOH1 MISSION shRNA Lentiviral Transduction Particles
atonal homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007500.2-1749s1c1
Sequence:CCGGCCCAGAATACACGCACTTCATCTCGAGATGAAGTGCGTGTATTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007500.2-769s1c1
Sequence:CCGGCTGTCCAAATATGAGACCCTACTCGAGTAGGGTCTCATATTTGGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007500.2-744s1c1
Sequence:CCGGCCCGTCCTTCAACAACGACAACTCGAGTTGTCGTTGTTGAAGGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007500.2-1189s1c1
Sequence:CCGGCACAGAAGTGACGGAGAGTTTCTCGAGAAACTCTCCGTCACTTCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007500.2-419s1c1
Sequence:CCGGCCGCCCAGTATCTGCTGCATTCTCGAGAATGCAGCAGATACTGGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007500.4-716s21c1
Sequence:CCGGGCAACGTTATCCCGTCCTTCACTCGAGTGAAGGACGGGATAACGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007500.4-1631s21c1
Sequence:CCGGCTTTACTGAACACGGACTATTCTCGAGAATAGTCCGTGTTCAGTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007500.4-806s21c1
Sequence:CCGGAGTTGCTGCAGACTCCCAATGCTCGAGCATTGGGAGTCTGCAGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007500.4-772s21c1
Sequence:CCGGCAGATGGCCCAGATCTACATCCTCGAGGATGTAGATCTGGGCCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007500.4-743s21c1
Sequence:CCGGACAAGAAGCTGTCCAAATATGCTCGAGCATATTTGGACAGCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)