EMAIL THIS PAGE TO A FRIEND

ATOH7

atonal homolog 7 (Drosophila)

59 Gene Product Result for
Synonyms: Math5 bHLHa13
UniProtKB ID: Q8N100
Gene ID:
Human(220202) Summary: This intronless gene encodes a member of the basic helix-loop-helix family of transcription factors, with similarity to Drosophila atonal gene that controls photoreceptor development. Studies in mice suggest that this gene plays a central role in retinal ganglion cell and optic nerve formation. Mutations in this gene are associated with nonsyndromic congenital retinal nonattachment. [provided by RefSeq, Dec 2011]
Mouse(53404) atonal homolog 7 (Drosophila)
Rat(365564) atonal homolog 7 (Drosophila)
naked mole-rat(101720646) atonal homolog 7 (Drosophila)
sheep(101104713) atonal homolog 7 (Drosophila)
Zebrafish(58216) atonal homolog 7
cow(539903) atonal homolog 7 (Drosophila)
domestic cat(101090048) atonal homolog 7 (Drosophila)
dog(489014) atonal homolog 7 (Drosophila)
chicken(395388) atonal homolog 7 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145178 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145178 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145178 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016864 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016864 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016864 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145178 Rosetta Predictions human pricing
XM_001080515 Rosetta Predictions rat pricing
XM_345102 Rosetta Predictions rat pricing
NM_016864 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028722 predicted 1042
2 SASI_Hs01_00028723 predicted 950
3 SASI_Hs01_00028724 predicted 1032
4 SASI_Hs01_00028725 predicted 956
5 SASI_Hs02_00365036 predicted 950
6 SASI_Hs01_00028726 predicted 1004
7 SASI_Hs01_00028727 predicted 1026
8 SASI_Hs01_00028728 predicted 1038
9 SASI_Hs01_00028730 predicted 1038
10 SASI_Hs01_00028731 predicted 802
11 SASI_Hs01_00028729 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080515 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368234 predicted 732
2 SASI_Rn02_00368235 predicted 803
3 SASI_Rn02_00368236 predicted 739
4 SASI_Rn02_00368237 predicted 756
5 SASI_Rn02_00368238 predicted 513
6 SASI_Rn02_00368239 predicted 636
7 SASI_Rn02_00368240 predicted 609
8 SASI_Rn02_00368241 predicted 514
9 SASI_Rn02_00368242 predicted 556
10 SASI_Rn02_00368243 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397981 predicted 724
2 SASI_Rn02_00397982 predicted 809
3 SASI_Rn02_00397983 predicted 742
4 SASI_Rn02_00397984 predicted 750
5 SASI_Rn02_00397985 predicted 516
6 SASI_Rn02_00397986 predicted 638
7 SASI_Rn02_00397987 predicted 607
8 SASI_Rn02_00397988 predicted 522
9 SASI_Rn02_00397989 predicted 557
10 SASI_Rn02_00397990 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152414 predicted 361
2 SASI_Mm01_00152415 predicted 376
3 SASI_Mm01_00152416 predicted 240
4 SASI_Mm01_00152417 predicted 245
5 SASI_Mm01_00152418 predicted 357
6 SASI_Mm01_00152419 predicted 263
7 SASI_Mm01_00152420 predicted 392
8 SASI_Mm02_00323655 predicted 228
9 SASI_Mm01_00152422 predicted 171
10 SASI_Mm01_00152423 predicted 309
11 SASI_Mm01_00152421 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145178
ATOH7 MISSION shRNA Bacterial Glycerol Stock
atonal homolog 7 (Drosophila)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145178.2-686s21c1
Sequence:CCGGATCATGGCTCTGACCCGGATCCTCGAGGATCCGGGTCAGAGCCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145178.2-1270s21c1
Sequence:CCGGGTGAAGTTACAGTATCCATTACTCGAGTAATGGATACTGTAACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145178.2-772s1c1
Sequence:CCGGCCGCGACCACTACCTCCCGTTCTCGAGAACGGGAGGTAGTGGTCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145178.2-674s1c1
Sequence:CCGGGCCCTGAGCTACATCATGGCTCTCGAGAGCCATGATGTAGCTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145178.2-601s1c1
Sequence:CCGGCGACCGCTTACGCAGGGTGGTCTCGAGACCACCCTGCGTAAGCGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145178.2-829s1c1
Sequence:CCGGCAGCCAGAGACTCTTCGGCTTCTCGAGAAGCCGAAGAGTCTCTGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145178
ATOH7 MISSION shRNA shRNA Plasmid DNA
atonal homolog 7 (Drosophila)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145178.2-686s21c1
Sequence:CCGGATCATGGCTCTGACCCGGATCCTCGAGGATCCGGGTCAGAGCCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145178.2-1270s21c1
Sequence:CCGGGTGAAGTTACAGTATCCATTACTCGAGTAATGGATACTGTAACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145178.2-772s1c1
Sequence:CCGGCCGCGACCACTACCTCCCGTTCTCGAGAACGGGAGGTAGTGGTCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145178.2-674s1c1
Sequence:CCGGGCCCTGAGCTACATCATGGCTCTCGAGAGCCATGATGTAGCTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145178.2-601s1c1
Sequence:CCGGCGACCGCTTACGCAGGGTGGTCTCGAGACCACCCTGCGTAAGCGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145178.2-829s1c1
Sequence:CCGGCAGCCAGAGACTCTTCGGCTTCTCGAGAAGCCGAAGAGTCTCTGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145178
ATOH7 MISSION shRNA Lentiviral Transduction Particles
atonal homolog 7 (Drosophila)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145178.2-686s21c1
Sequence:CCGGATCATGGCTCTGACCCGGATCCTCGAGGATCCGGGTCAGAGCCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145178.2-1270s21c1
Sequence:CCGGGTGAAGTTACAGTATCCATTACTCGAGTAATGGATACTGTAACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145178.2-772s1c1
Sequence:CCGGCCGCGACCACTACCTCCCGTTCTCGAGAACGGGAGGTAGTGGTCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145178.2-674s1c1
Sequence:CCGGGCCCTGAGCTACATCATGGCTCTCGAGAGCCATGATGTAGCTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145178.2-601s1c1
Sequence:CCGGCGACCGCTTACGCAGGGTGGTCTCGAGACCACCCTGCGTAAGCGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145178.2-829s1c1
Sequence:CCGGCAGCCAGAGACTCTTCGGCTTCTCGAGAAGCCGAAGAGTCTCTGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016864
ATOH7 MISSION shRNA Bacterial Glycerol Stock
atonal homolog 7 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016864.1-215s1c1
Sequence:CCGGGCCAGGACAAGAAGCTGTCCACTCGAGTGGACAGCTTCTTGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016864.1-260s1c1
Sequence:CCGGTCAGCTACATCATCGCGCTCACTCGAGTGAGCGCGATGATGTAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016864.1-231s1c1
Sequence:CCGGGTCCAAGTACGAGACACTGCACTCGAGTGCAGTGTCTCGTACTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016864.1-249s1c1
Sequence:CCGGGCAGATGGCGCTCAGCTACATCTCGAGATGTAGCTGAGCGCCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016864.1-277s1c1
Sequence:CCGGCTCACCCGCATCCTAGCCGAACTCGAGTTCGGCTAGGATGCGGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016864
ATOH7 MISSION shRNA shRNA Plasmid DNA
atonal homolog 7 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016864.1-215s1c1
Sequence:CCGGGCCAGGACAAGAAGCTGTCCACTCGAGTGGACAGCTTCTTGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016864.1-260s1c1
Sequence:CCGGTCAGCTACATCATCGCGCTCACTCGAGTGAGCGCGATGATGTAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016864.1-231s1c1
Sequence:CCGGGTCCAAGTACGAGACACTGCACTCGAGTGCAGTGTCTCGTACTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016864.1-249s1c1
Sequence:CCGGGCAGATGGCGCTCAGCTACATCTCGAGATGTAGCTGAGCGCCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016864.1-277s1c1
Sequence:CCGGCTCACCCGCATCCTAGCCGAACTCGAGTTCGGCTAGGATGCGGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016864
ATOH7 MISSION shRNA Lentiviral Transduction Particles
atonal homolog 7 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016864.1-215s1c1
Sequence:CCGGGCCAGGACAAGAAGCTGTCCACTCGAGTGGACAGCTTCTTGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016864.1-260s1c1
Sequence:CCGGTCAGCTACATCATCGCGCTCACTCGAGTGAGCGCGATGATGTAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016864.1-231s1c1
Sequence:CCGGGTCCAAGTACGAGACACTGCACTCGAGTGCAGTGTCTCGTACTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016864.1-249s1c1
Sequence:CCGGGCAGATGGCGCTCAGCTACATCTCGAGATGTAGCTGAGCGCCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016864.1-277s1c1
Sequence:CCGGCTCACCCGCATCCTAGCCGAACTCGAGTTCGGCTAGGATGCGGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks