EMAIL THIS PAGE TO A FRIEND

ATOH8

atonal homolog 8 (Drosophila)

59 Gene Product Result for
Synonyms: HATH6 bHLHa21
UniProtKB ID: Q96SQ7, Q504S2, Q659B0
Gene ID:
Mouse(71093) atonal homolog 8 (Drosophila)
Rat(500200) atonal homolog 8 (Drosophila)
Zebrafish(561606) atonal homolog 8
chicken(771738) atonal homolog 8 (Drosophila)
dog(612024) atonal homolog 8 (Drosophila)
domestic cat(101091861) atonal homolog 8 (Drosophila)
cow(616225) atonal homolog 8 (Drosophila)
sheep(101102971) atonal homolog 8 (Drosophila)
naked mole-rat(101699666) atonal homolog 8 (Drosophila)
domestic guinea pig(100729169) atonal homolog 8 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV39728 Anti-ATOH8 antibody produced in rabbit IgG fraction of antiserum rat, canine, horse, mouse, rabbit, guinea pig, human
western blot pricing
SAB3500026 Anti-ATOH8 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
HPA028406 Anti-ATOH8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032827 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032827 Rosetta Predictions human pricing
NM_001109241 Rosetta Predictions rat pricing
NM_153778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025457 predicted 1053
2 SASI_Hs01_00025458 predicted 1358
3 SASI_Hs01_00025459 predicted 1694
4 SASI_Hs01_00025460 predicted 1693
5 SASI_Hs01_00025461 predicted 1036
6 SASI_Hs01_00025462 predicted 1559
7 SASI_Hs01_00025464 predicted 1655
8 SASI_Hs01_00025465 predicted 1454
9 SASI_Hs02_00360419 predicted 1537
10 SASI_Hs01_00025466 predicted 1312
11 SASI_Hs01_00025463 predicted 1253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246474 predicted 1846
2 SASI_Rn02_00246475 predicted 842
3 SASI_Rn02_00246476 predicted 1720
4 SASI_Rn02_00246477 predicted 1865
5 SASI_Rn02_00246478 predicted 1368
6 SASI_Rn02_00246479 predicted 992
7 SASI_Rn02_00246480 predicted 1807
8 SASI_Rn02_00246481 predicted 687
9 SASI_Rn02_00246482 predicted 1189
10 SASI_Rn02_00246483 predicted 1788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150893 predicted 1780
2 SASI_Mm01_00150894 predicted 1158
3 SASI_Mm01_00150895 predicted 1520
4 SASI_Mm01_00150896 predicted 1700
5 SASI_Mm01_00150897 predicted 1616
6 SASI_Mm01_00150898 predicted 986
7 SASI_Mm01_00150899 predicted 1470
8 SASI_Mm01_00150900 predicted 1767
9 SASI_Mm01_00150901 predicted 1398
10 SASI_Mm02_00343499 predicted 1483
11 SASI_Mm01_00150902 predicted 1367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032827
VALIDATED
ATOH8 MISSION shRNA Bacterial Glycerol Stock
atonal homolog 8 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032827.3-871s1c1
Sequence:CCGGCTCGTCAATTTCACACGTAATCTCGAGATTACGTGTGAAATTGACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032827.3-1108s1c1
Sequence:CCGGCCTGAGGATCGCCTGTAACTACTCGAGTAGTTACAGGCGATCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032827.3-355s1c1
Sequence:CCGGGAACGGCCTTAAGAAGCTCAACTCGAGTTGAGCTTCTTAAGGCCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032827.3-1069s1c1
Sequence:CCGGGTGCTACTCATATGGGCAGAACTCGAGTTCTGCCCATATGAGTAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032827.3-860s1c1
Sequence:CCGGGAAAGTTCCTACTCGTCAATTCTCGAGAATTGACGAGTAGGAACTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032827.6-1170s21c1
Sequence:CCGGCAGGTGCCGTGCTACTCATATCTCGAGATATGAGTAGCACGGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032827.6-1215s21c1
Sequence:CCGGATCCTGAGGATCGCCTGTAACCTCGAGGTTACAGGCGATCCTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032827.6-1001s21c1
Sequence:CCGGTTACAATAACCACCAGGATTCCTCGAGGAATCCTGGTGGTTATTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032827.6-969s21c1
Sequence:CCGGGAAAGTTCCTACTCGTCAATTCTCGAGAATTGACGAGTAGGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032827.6-464s21c1
Sequence:CCGGGAACGGCCTTAAGAAGCTCAACTCGAGTTGAGCTTCTTAAGGCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032827
VALIDATED
ATOH8 MISSION shRNA shRNA Plasmid DNA
atonal homolog 8 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032827.3-871s1c1
Sequence:CCGGCTCGTCAATTTCACACGTAATCTCGAGATTACGTGTGAAATTGACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032827.3-1108s1c1
Sequence:CCGGCCTGAGGATCGCCTGTAACTACTCGAGTAGTTACAGGCGATCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032827.3-355s1c1
Sequence:CCGGGAACGGCCTTAAGAAGCTCAACTCGAGTTGAGCTTCTTAAGGCCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032827.3-1069s1c1
Sequence:CCGGGTGCTACTCATATGGGCAGAACTCGAGTTCTGCCCATATGAGTAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032827.3-860s1c1
Sequence:CCGGGAAAGTTCCTACTCGTCAATTCTCGAGAATTGACGAGTAGGAACTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032827.6-1170s21c1
Sequence:CCGGCAGGTGCCGTGCTACTCATATCTCGAGATATGAGTAGCACGGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032827.6-1215s21c1
Sequence:CCGGATCCTGAGGATCGCCTGTAACCTCGAGGTTACAGGCGATCCTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032827.6-1001s21c1
Sequence:CCGGTTACAATAACCACCAGGATTCCTCGAGGAATCCTGGTGGTTATTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032827.6-969s21c1
Sequence:CCGGGAAAGTTCCTACTCGTCAATTCTCGAGAATTGACGAGTAGGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032827.6-464s21c1
Sequence:CCGGGAACGGCCTTAAGAAGCTCAACTCGAGTTGAGCTTCTTAAGGCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032827
VALIDATED
ATOH8 MISSION shRNA Lentiviral Transduction Particles
atonal homolog 8 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032827.3-871s1c1
Sequence:CCGGCTCGTCAATTTCACACGTAATCTCGAGATTACGTGTGAAATTGACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032827.3-1108s1c1
Sequence:CCGGCCTGAGGATCGCCTGTAACTACTCGAGTAGTTACAGGCGATCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032827.3-355s1c1
Sequence:CCGGGAACGGCCTTAAGAAGCTCAACTCGAGTTGAGCTTCTTAAGGCCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032827.3-1069s1c1
Sequence:CCGGGTGCTACTCATATGGGCAGAACTCGAGTTCTGCCCATATGAGTAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032827.3-860s1c1
Sequence:CCGGGAAAGTTCCTACTCGTCAATTCTCGAGAATTGACGAGTAGGAACTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032827.6-1170s21c1
Sequence:CCGGCAGGTGCCGTGCTACTCATATCTCGAGATATGAGTAGCACGGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032827.6-1215s21c1
Sequence:CCGGATCCTGAGGATCGCCTGTAACCTCGAGGTTACAGGCGATCCTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032827.6-1001s21c1
Sequence:CCGGTTACAATAACCACCAGGATTCCTCGAGGAATCCTGGTGGTTATTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032827.6-969s21c1
Sequence:CCGGGAAAGTTCCTACTCGTCAATTCTCGAGAATTGACGAGTAGGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032827.6-464s21c1
Sequence:CCGGGAACGGCCTTAAGAAGCTCAACTCGAGTTGAGCTTCTTAAGGCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153778
ATOH8 MISSION shRNA Bacterial Glycerol Stock
atonal homolog 8 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153778.2-1722s1c1
Sequence:CCGGCCTCAAGCCAAAGATGGATTACTCGAGTAATCCATCTTTGGCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153778.2-1231s1c1
Sequence:CCGGCCTGAGGATTGCCTGTAACTACTCGAGTAGTTACAGGCAATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153778.2-448s1c1
Sequence:CCGGGTGGAAGACTGTGTGCGTTAACTCGAGTTAACGCACACAGTCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153778.2-993s1c1
Sequence:CCGGACTCGTCAATTTCACACGTAACTCGAGTTACGTGTGAAATTGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153778.2-996s1c1
Sequence:CCGGCGTCAATTTCACACGTAATTTCTCGAGAAATTACGTGTGAAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153778.3-1072s21c1
Sequence:CCGGCCGCCTCAACGGAGATCAAAGCTCGAGCTTTGATCTCCGTTGAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153778.3-1520s21c1
Sequence:CCGGCCATCTCTCAGGGTCACTTAGCTCGAGCTAAGTGACCCTGAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153778.3-1648s21c1
Sequence:CCGGAGATCGTCCAAGGAAATTATGCTCGAGCATAATTTCCTTGGACGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153778.3-1622s21c1
Sequence:CCGGGCGGGCTATTGCCAAAGATTCCTCGAGGAATCTTTGGCAATAGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153778
ATOH8 MISSION shRNA shRNA Plasmid DNA
atonal homolog 8 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153778.2-1722s1c1
Sequence:CCGGCCTCAAGCCAAAGATGGATTACTCGAGTAATCCATCTTTGGCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153778.2-1231s1c1
Sequence:CCGGCCTGAGGATTGCCTGTAACTACTCGAGTAGTTACAGGCAATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153778.2-448s1c1
Sequence:CCGGGTGGAAGACTGTGTGCGTTAACTCGAGTTAACGCACACAGTCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153778.2-993s1c1
Sequence:CCGGACTCGTCAATTTCACACGTAACTCGAGTTACGTGTGAAATTGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153778.2-996s1c1
Sequence:CCGGCGTCAATTTCACACGTAATTTCTCGAGAAATTACGTGTGAAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153778.3-1072s21c1
Sequence:CCGGCCGCCTCAACGGAGATCAAAGCTCGAGCTTTGATCTCCGTTGAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153778.3-1520s21c1
Sequence:CCGGCCATCTCTCAGGGTCACTTAGCTCGAGCTAAGTGACCCTGAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153778.3-1648s21c1
Sequence:CCGGAGATCGTCCAAGGAAATTATGCTCGAGCATAATTTCCTTGGACGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153778.3-1622s21c1
Sequence:CCGGGCGGGCTATTGCCAAAGATTCCTCGAGGAATCTTTGGCAATAGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153778
ATOH8 MISSION shRNA Lentiviral Transduction Particles
atonal homolog 8 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153778.2-1722s1c1
Sequence:CCGGCCTCAAGCCAAAGATGGATTACTCGAGTAATCCATCTTTGGCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153778.2-1231s1c1
Sequence:CCGGCCTGAGGATTGCCTGTAACTACTCGAGTAGTTACAGGCAATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153778.2-448s1c1
Sequence:CCGGGTGGAAGACTGTGTGCGTTAACTCGAGTTAACGCACACAGTCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153778.2-993s1c1
Sequence:CCGGACTCGTCAATTTCACACGTAACTCGAGTTACGTGTGAAATTGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153778.2-996s1c1
Sequence:CCGGCGTCAATTTCACACGTAATTTCTCGAGAAATTACGTGTGAAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153778.3-1072s21c1
Sequence:CCGGCCGCCTCAACGGAGATCAAAGCTCGAGCTTTGATCTCCGTTGAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153778.3-1520s21c1
Sequence:CCGGCCATCTCTCAGGGTCACTTAGCTCGAGCTAAGTGACCCTGAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153778.3-1648s21c1
Sequence:CCGGAGATCGTCCAAGGAAATTATGCTCGAGCATAATTTCCTTGGACGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153778.3-1622s21c1
Sequence:CCGGGCGGGCTATTGCCAAAGATTCCTCGAGGAATCTTTGGCAATAGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks