EMAIL THIS PAGE TO A FRIEND

ATOX1

antioxidant 1 copper chaperone

68 Gene Product Result for
Synonyms: ATX1 HAH1
UniProtKB ID: O00244, A8KAJ8, D3DQI2, Q2M1R6, Q56AP3
Gene ID:
Human(475) Summary: This gene encodes a copper chaperone that plays a role in copper homeostasis by binding and transporting cytosolic copper to ATPase proteins in the trans-Golgi network for later incorporation to the ceruloplasmin. This protein also functions as an antioxidant against superoxide and hydrogen peroxide, and therefore, may play a significant role in cancer carcinogenesis. Because of its cytogenetic location, this gene represents a candidate gene for 5q-syndrome. [provided by RefSeq, Jul 2008]
Mouse(11927) ATX1 (antioxidant protein 1) homolog 1 (yeast)
Rat(84355) antioxidant 1 copper chaperone
domestic guinea pig(100715011) antioxidant 1 copper chaperone
naked mole-rat(101697402) antioxidant 1 copper chaperone
sheep(443451) ATX1 antioxidant protein 1 homolog (yeast)
Zebrafish(558347) ATX1 antioxidant protein 1 homolog (yeast)
fruit fly(326216) CG32446 gene product from transcript CG32446-RA
dog(403713) ATX1 antioxidant protein 1 homolog (yeast)
cow(613998) ATX1 antioxidant protein 1 homolog (yeast)
domestic cat(101084170) ATX1 antioxidant protein 1 homolog (yeast)
chicken(770231) ATX1 antioxidant protein 1 homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1104863 Anti-ATOX1 (53-64) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
HPA055036 Anti-ATOX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
WH0000475M1 Monoclonal Anti-ATOX1 antibody produced in mouse clone 2E6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403585 Monoclonal Anti-ATOX1 antibody produced in mouse clone 3A2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409348 Monoclonal Anti-ATOX1 antibody produced in mouse clone 3D10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409349 Monoclonal Anti-ATOX1 antibody produced in mouse clone 3G11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409350 Monoclonal Anti-ATOX1 antibody produced in mouse clone 3E1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409351 Monoclonal Anti-ATOX1 antibody produced in mouse clone 3F7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409352 Monoclonal Anti-ATOX1 antibody produced in mouse clone 4D6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409353 Monoclonal Anti-ATOX1 antibody produced in mouse clone 3B7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409354 Monoclonal Anti-ATOX1 antibody produced in mouse clone 3A1, ascites fluid, solution human
ELISA, western blot pricing
SAB1409355 Monoclonal Anti-ATOX1 antibody produced in mouse clone 3D10, ascites fluid, solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004045 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU046811 MISSION® esiRNA esiRNA targeting mouse Atox1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004045 Rosetta Predictions human pricing
NM_053359 Rosetta Predictions rat pricing
NM_009720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029009 predicted 207
2 SASI_Hs01_00029010 predicted 238
3 SASI_Hs01_00029011 predicted 201
4 SASI_Hs01_00029012 predicted 205
5 SASI_Hs01_00029013 predicted 216
6 SASI_Hs01_00029014 predicted 199
7 SASI_Hs01_00029015 predicted 205
8 SASI_Hs01_00029016 predicted 246
9 SASI_Hs01_00029017 predicted 239
10 SASI_Hs02_00336801 predicted 204
11 SASI_Hs01_00029008 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052251 predicted 362
2 SASI_Rn02_00265827 predicted 329
3 SASI_Rn01_00052252 predicted 174
4 SASI_Rn02_00265828 predicted 458
5 SASI_Rn01_00052253 predicted 442
6 SASI_Rn02_00265829 predicted 451
7 SASI_Rn02_00265830 predicted 446
8 SASI_Rn02_00265831 predicted 234
9 SASI_Rn02_00265832 predicted 300
10 SASI_Rn02_00265833 predicted 237
11 SASI_Rn01_00052254 predicted 136
12 SASI_Rn01_00052255 predicted 122
13 SASI_Rn01_00052256 predicted 250
14 SASI_Rn01_00052257 predicted 210
15 SASI_Rn01_00052258 predicted 105
16 SASI_Rn01_00052259 predicted 189
17 SASI_Rn01_00052260 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142060 predicted 396
2 SASI_Mm01_00142061 predicted 397
3 SASI_Mm01_00142062 predicted 271
4 SASI_Mm01_00142063 predicted 120
5 SASI_Mm01_00142064 predicted 399
6 SASI_Mm01_00142065 predicted 53
7 SASI_Mm01_00142066 predicted 53
8 SASI_Mm01_00142067 predicted 401
9 SASI_Mm01_00142068 predicted 264
10 SASI_Mm02_00316876 predicted 145
11 SASI_Mm01_00142059 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004045
VALIDATED
ATOX1 MISSION shRNA Bacterial Glycerol Stock
antioxidant 1 copper chaperone
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-274s21c1
Sequence:CCGGGAAAGACTGTTTCCTACCTTGCTCGAGCAAGGTAGGAAACAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-230s21c1
Sequence:CCGGTGAGCACAGCATGGACACTCTCTCGAGAGAGTGTCCATGCTGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-194s21c1
Sequence:CCGGCATTGACCTGCCCAACAAGAACTCGAGTTCTTGTTGGGCAGGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-211s21c1
Sequence:CCGGAGAAGGTCTGCATTGAATCTGCTCGAGCAGATTCAATGCAGACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-167s21c1
Sequence:CCGGCAATAAGCTTGGAGGAGTTAACTCGAGTTAACTCCTCCAAGCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-153s21c1
Sequence:CCGGGTCTCTCGGGTCCTCAATAAGCTCGAGCTTATTGAGGACCCGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004045.2-452s1c1
Sequence:CCGGACAGCCCACAGGATGGACCCACTCGAGTGGGTCCATCCTGTGGGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004045.2-333s1c1
Sequence:CCGGGCCCAACAAGAAGGTCTGCATCTCGAGATGCAGACCTTCTTGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004045.2-306s1c1
Sequence:CCGGTGGAGGAGTTAAGTATGACATCTCGAGATGTCATACTTAACTCCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004045.2-409s1c1
Sequence:CCGGACTGTTTCCTACCTTGGGCTTCTCGAGAAGCCCAAGGTAGGAAACAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004045.2-350s1c1
Sequence:CCGGGCATTGAATCTGAGCACAGCACTCGAGTGCTGTGCTCAGATTCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004045
VALIDATED
ATOX1 MISSION shRNA shRNA Plasmid DNA
antioxidant 1 copper chaperone
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-274s21c1
Sequence:CCGGGAAAGACTGTTTCCTACCTTGCTCGAGCAAGGTAGGAAACAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-230s21c1
Sequence:CCGGTGAGCACAGCATGGACACTCTCTCGAGAGAGTGTCCATGCTGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-194s21c1
Sequence:CCGGCATTGACCTGCCCAACAAGAACTCGAGTTCTTGTTGGGCAGGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-211s21c1
Sequence:CCGGAGAAGGTCTGCATTGAATCTGCTCGAGCAGATTCAATGCAGACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-167s21c1
Sequence:CCGGCAATAAGCTTGGAGGAGTTAACTCGAGTTAACTCCTCCAAGCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-153s21c1
Sequence:CCGGGTCTCTCGGGTCCTCAATAAGCTCGAGCTTATTGAGGACCCGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004045.2-452s1c1
Sequence:CCGGACAGCCCACAGGATGGACCCACTCGAGTGGGTCCATCCTGTGGGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004045.2-333s1c1
Sequence:CCGGGCCCAACAAGAAGGTCTGCATCTCGAGATGCAGACCTTCTTGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004045.2-306s1c1
Sequence:CCGGTGGAGGAGTTAAGTATGACATCTCGAGATGTCATACTTAACTCCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004045.2-409s1c1
Sequence:CCGGACTGTTTCCTACCTTGGGCTTCTCGAGAAGCCCAAGGTAGGAAACAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004045.2-350s1c1
Sequence:CCGGGCATTGAATCTGAGCACAGCACTCGAGTGCTGTGCTCAGATTCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004045
VALIDATED
ATOX1 MISSION shRNA Lentiviral Transduction Particles
antioxidant 1 copper chaperone
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-274s21c1
Sequence:CCGGGAAAGACTGTTTCCTACCTTGCTCGAGCAAGGTAGGAAACAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-230s21c1
Sequence:CCGGTGAGCACAGCATGGACACTCTCTCGAGAGAGTGTCCATGCTGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-194s21c1
Sequence:CCGGCATTGACCTGCCCAACAAGAACTCGAGTTCTTGTTGGGCAGGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-211s21c1
Sequence:CCGGAGAAGGTCTGCATTGAATCTGCTCGAGCAGATTCAATGCAGACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-167s21c1
Sequence:CCGGCAATAAGCTTGGAGGAGTTAACTCGAGTTAACTCCTCCAAGCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004045.3-153s21c1
Sequence:CCGGGTCTCTCGGGTCCTCAATAAGCTCGAGCTTATTGAGGACCCGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004045.2-452s1c1
Sequence:CCGGACAGCCCACAGGATGGACCCACTCGAGTGGGTCCATCCTGTGGGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004045.2-333s1c1
Sequence:CCGGGCCCAACAAGAAGGTCTGCATCTCGAGATGCAGACCTTCTTGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004045.2-306s1c1
Sequence:CCGGTGGAGGAGTTAAGTATGACATCTCGAGATGTCATACTTAACTCCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004045.2-409s1c1
Sequence:CCGGACTGTTTCCTACCTTGGGCTTCTCGAGAAGCCCAAGGTAGGAAACAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004045.2-350s1c1
Sequence:CCGGGCATTGAATCTGAGCACAGCACTCGAGTGCTGTGCTCAGATTCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009720
VALIDATED
ATOX1 MISSION shRNA Bacterial Glycerol Stock
antioxidant 1 copper chaperone
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009720.2-264s21c1
Sequence:CCGGGCGAGTCCTTCCGGATATAAACTCGAGTTTATATCCGGAAGGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009720.2-167s21c1
Sequence:CCGGGCATCGACTCTGAGCACAGCTCTCGAGAGCTGTGCTCAGAGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009720.2-141s21c1
Sequence:CCGGCATTGACCTGCCCAACAAGAACTCGAGTTCTTGTTGGGCAGGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009720.2-221s21c1
Sequence:CCGGGAAAGGCTGTTTCCTACCTTGCTCGAGCAAGGTAGGAAACAGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009720.2-100s21c1
Sequence:CCGGGTCTCCAGAGTCCTCAACAAGCTCGAGCTTGTTGAGGACTCTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009720.2-264s1c1
Sequence:CCGGGCGAGTCCTTCCGGATATAAACTCGAGTTTATATCCGGAAGGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009720.2-167s1c1
Sequence:CCGGGCATCGACTCTGAGCACAGCTCTCGAGAGCTGTGCTCAGAGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009720.2-109s1c1
Sequence:CCGGGTCCTCAACAAGCTGGGAGGACTCGAGTCCTCCCAGCTTGTTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009720.2-134s1c1
Sequence:CCGGAGTTCAACATTGACCTGCCCACTCGAGTGGGCAGGTCAATGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009720.2-219s1c1
Sequence:CCGGAGGAAAGGCTGTTTCCTACCTCTCGAGAGGTAGGAAACAGCCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009720
VALIDATED
ATOX1 MISSION shRNA shRNA Plasmid DNA
antioxidant 1 copper chaperone
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009720.2-264s21c1
Sequence:CCGGGCGAGTCCTTCCGGATATAAACTCGAGTTTATATCCGGAAGGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009720.2-167s21c1
Sequence:CCGGGCATCGACTCTGAGCACAGCTCTCGAGAGCTGTGCTCAGAGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009720.2-141s21c1
Sequence:CCGGCATTGACCTGCCCAACAAGAACTCGAGTTCTTGTTGGGCAGGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009720.2-221s21c1
Sequence:CCGGGAAAGGCTGTTTCCTACCTTGCTCGAGCAAGGTAGGAAACAGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009720.2-100s21c1
Sequence:CCGGGTCTCCAGAGTCCTCAACAAGCTCGAGCTTGTTGAGGACTCTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009720.2-264s1c1
Sequence:CCGGGCGAGTCCTTCCGGATATAAACTCGAGTTTATATCCGGAAGGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009720.2-167s1c1
Sequence:CCGGGCATCGACTCTGAGCACAGCTCTCGAGAGCTGTGCTCAGAGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009720.2-109s1c1
Sequence:CCGGGTCCTCAACAAGCTGGGAGGACTCGAGTCCTCCCAGCTTGTTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009720.2-134s1c1
Sequence:CCGGAGTTCAACATTGACCTGCCCACTCGAGTGGGCAGGTCAATGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009720.2-219s1c1
Sequence:CCGGAGGAAAGGCTGTTTCCTACCTCTCGAGAGGTAGGAAACAGCCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009720
VALIDATED
ATOX1 MISSION shRNA Lentiviral Transduction Particles
antioxidant 1 copper chaperone
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009720.2-264s21c1
Sequence:CCGGGCGAGTCCTTCCGGATATAAACTCGAGTTTATATCCGGAAGGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009720.2-167s21c1
Sequence:CCGGGCATCGACTCTGAGCACAGCTCTCGAGAGCTGTGCTCAGAGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009720.2-141s21c1
Sequence:CCGGCATTGACCTGCCCAACAAGAACTCGAGTTCTTGTTGGGCAGGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009720.2-221s21c1
Sequence:CCGGGAAAGGCTGTTTCCTACCTTGCTCGAGCAAGGTAGGAAACAGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009720.2-100s21c1
Sequence:CCGGGTCTCCAGAGTCCTCAACAAGCTCGAGCTTGTTGAGGACTCTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009720.2-264s1c1
Sequence:CCGGGCGAGTCCTTCCGGATATAAACTCGAGTTTATATCCGGAAGGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009720.2-167s1c1
Sequence:CCGGGCATCGACTCTGAGCACAGCTCTCGAGAGCTGTGCTCAGAGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009720.2-109s1c1
Sequence:CCGGGTCCTCAACAAGCTGGGAGGACTCGAGTCCTCCCAGCTTGTTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009720.2-134s1c1
Sequence:CCGGAGTTCAACATTGACCTGCCCACTCGAGTGGGCAGGTCAATGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009720.2-219s1c1
Sequence:CCGGAGGAAAGGCTGTTTCCTACCTCTCGAGAGGTAGGAAACAGCCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks