EMAIL THIS PAGE TO A FRIEND

ATP10B

ATPase, class V, type 10B

181 Gene Product Result for
Synonyms: ATPVB
UniProtKB ID: O94823, Q9H725
Gene ID:
Mouse(319767) ATPase, class V, type 10B
Rat(303056) ATPase, class V, type 10B
domestic guinea pig(100718505) ATPase, class V, type 10B
naked mole-rat(101722473) ATPase, class V, type 10B
sheep(101117246) ATPase, class V, type 10B
chicken(416159) ATPase, class V, type 10B
dog(489148) ATPase, class V, type 10B
cow(100336948) ATPase, class V, type 10B
domestic cat(101084853) ATPase, class V, type 10B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025153 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176999 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176999 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176999 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092451 MISSION® esiRNA esiRNA human ATP10B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025153 Rosetta Predictions human pricing
XM_927593 Rosetta Predictions human pricing
XM_001067759 Rosetta Predictions rat pricing
XM_220314 Rosetta Predictions rat pricing
NM_176999 Rosetta Predictions mouse pricing
XM_618860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357890 predicted 2041
2 SASI_Hs02_00357891 predicted 2018
3 SASI_Hs02_00357892 predicted 2191
4 SASI_Hs02_00357893 predicted 3131
5 SASI_Hs02_00357894 predicted 3359
6 SASI_Hs02_00357895 predicted 4486
7 SASI_Hs02_00357896 predicted 4024
8 SASI_Hs02_00357897 predicted 4805
9 SASI_Hs02_00357898 predicted 1252
10 SASI_Hs02_00357899 predicted 3969
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261266 predicted 1996
2 SASI_Hs01_00261267 predicted 1979
3 SASI_Hs01_00261268 predicted 2145
4 SASI_Hs01_00261269 predicted 3095
5 SASI_Hs01_00261270 predicted 3312
6 SASI_Hs01_00261271 predicted 4440
7 SASI_Hs01_00261272 predicted 3987
8 SASI_Hs01_00261273 predicted 5220
9 SASI_Hs01_00261274 predicted 4759
10 SASI_Hs01_00261275 predicted 1204
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067759 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322188 predicted 536
2 SASI_Rn02_00322189 predicted 1341
3 SASI_Rn02_00322190 predicted 1137
4 SASI_Rn02_00322191 predicted 3121
5 SASI_Rn02_00322192 predicted 2927
6 SASI_Rn02_00322193 predicted 3033
7 SASI_Rn02_00322194 predicted 3952
8 SASI_Rn02_00322195 predicted 413
9 SASI_Rn02_00322196 predicted 726
10 SASI_Rn02_00322197 predicted 1734
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220314 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379215 predicted 707
2 SASI_Rn02_00379216 predicted 1510
3 SASI_Rn02_00379217 predicted 1312
4 SASI_Rn02_00379218 predicted 3288
5 SASI_Rn02_00379219 predicted 3096
6 SASI_Rn02_00379220 predicted 3208
7 SASI_Rn02_00379221 predicted 4122
8 SASI_Rn02_00379222 predicted 583
9 SASI_Rn02_00379223 predicted 893
10 SASI_Rn02_00379224 predicted 1903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176999 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346934 predicted 4509
2 SASI_Mm02_00346935 predicted 3212
3 SASI_Mm02_00346936 predicted 844
4 SASI_Mm02_00346937 predicted 3025
5 SASI_Mm02_00346938 predicted 3571
6 SASI_Mm02_00346939 predicted 1030
7 SASI_Mm02_00346940 predicted 4038
8 SASI_Mm02_00346941 predicted 1242
9 SASI_Mm02_00346942 predicted 1439
10 SASI_Mm02_00346943 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_618860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242952 predicted 3515
2 SASI_Mm01_00242953 predicted 2979
3 SASI_Mm01_00242954 predicted 593
4 SASI_Mm01_00242955 predicted 2785
5 SASI_Mm01_00242956 predicted 3336
6 SASI_Mm01_00242957 predicted 777
7 SASI_Mm01_00242958 predicted 246
8 SASI_Mm01_00242959 predicted 987
9 SASI_Mm01_00242960 predicted 1839
10 SASI_Mm01_00242961 predicted 1186
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025153
ATP10B MISSION shRNA Bacterial Glycerol Stock
ATPase, class V, type 10B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025153.2-1292s21c1
Sequence:CCGGTGCTCCAACATTCGAATTTATCTCGAGATAAATTCGAATGTTGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025153.2-4032s21c1
Sequence:CCGGTGATTCAAGCTGCTGATATTGCTCGAGCAATATCAGCAGCTTGAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025153.2-4102s21c1
Sequence:CCGGCTTTGCCATCACCCGCTTTAACTCGAGTTAAAGCGGGTGATGGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025153.2-2061s21c1
Sequence:CCGGATGATGAAGAGACCGATTTATCTCGAGATAAATCGGTCTCTTCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025153.2-6493s21c1
Sequence:CCGGCCTTAAGCTAGTACCTATATACTCGAGTATATAGGTACTAGCTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025153
ATP10B MISSION shRNA shRNA Plasmid DNA
ATPase, class V, type 10B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025153.2-1292s21c1
Sequence:CCGGTGCTCCAACATTCGAATTTATCTCGAGATAAATTCGAATGTTGGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025153.2-4032s21c1
Sequence:CCGGTGATTCAAGCTGCTGATATTGCTCGAGCAATATCAGCAGCTTGAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025153.2-4102s21c1
Sequence:CCGGCTTTGCCATCACCCGCTTTAACTCGAGTTAAAGCGGGTGATGGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025153.2-2061s21c1
Sequence:CCGGATGATGAAGAGACCGATTTATCTCGAGATAAATCGGTCTCTTCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025153.2-6493s21c1
Sequence:CCGGCCTTAAGCTAGTACCTATATACTCGAGTATATAGGTACTAGCTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025153
ATP10B MISSION shRNA Lentiviral Transduction Particles
ATPase, class V, type 10B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025153.2-1292s21c1
Sequence:CCGGTGCTCCAACATTCGAATTTATCTCGAGATAAATTCGAATGTTGGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025153.2-4032s21c1
Sequence:CCGGTGATTCAAGCTGCTGATATTGCTCGAGCAATATCAGCAGCTTGAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025153.2-4102s21c1
Sequence:CCGGCTTTGCCATCACCCGCTTTAACTCGAGTTAAAGCGGGTGATGGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025153.2-2061s21c1
Sequence:CCGGATGATGAAGAGACCGATTTATCTCGAGATAAATCGGTCTCTTCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025153.2-6493s21c1
Sequence:CCGGCCTTAAGCTAGTACCTATATACTCGAGTATATAGGTACTAGCTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176999
ATP10B MISSION shRNA Bacterial Glycerol Stock
ATPase, class V, type 10B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176999.2-2542s1c1
Sequence:CCGGCCGGAGATACAAATCTGATAACTCGAGTTATCAGATTTGTATCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176999.2-438s1c1
Sequence:CCGGCCACAGGGAAATCACCATATTCTCGAGAATATGGTGATTTCCCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176999.2-535s1c1
Sequence:CCGGGAGATGAATAGTGCCAGCATTCTCGAGAATGCTGGCACTATTCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176999.2-508s1c1
Sequence:CCGGGACTTCAAGAGATATTGCTTTCTCGAGAAAGCAATATCTCTTGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176999.2-399s1c1
Sequence:CCGGCCTGGTGATTCTGAACTGGATCTCGAGATCCAGTTCAGAATCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176999
ATP10B MISSION shRNA shRNA Plasmid DNA
ATPase, class V, type 10B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176999.2-2542s1c1
Sequence:CCGGCCGGAGATACAAATCTGATAACTCGAGTTATCAGATTTGTATCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176999.2-438s1c1
Sequence:CCGGCCACAGGGAAATCACCATATTCTCGAGAATATGGTGATTTCCCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176999.2-535s1c1
Sequence:CCGGGAGATGAATAGTGCCAGCATTCTCGAGAATGCTGGCACTATTCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176999.2-508s1c1
Sequence:CCGGGACTTCAAGAGATATTGCTTTCTCGAGAAAGCAATATCTCTTGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176999.2-399s1c1
Sequence:CCGGCCTGGTGATTCTGAACTGGATCTCGAGATCCAGTTCAGAATCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176999
ATP10B MISSION shRNA Lentiviral Transduction Particles
ATPase, class V, type 10B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176999.2-2542s1c1
Sequence:CCGGCCGGAGATACAAATCTGATAACTCGAGTTATCAGATTTGTATCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176999.2-438s1c1
Sequence:CCGGCCACAGGGAAATCACCATATTCTCGAGAATATGGTGATTTCCCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176999.2-535s1c1
Sequence:CCGGGAGATGAATAGTGCCAGCATTCTCGAGAATGCTGGCACTATTCATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176999.2-508s1c1
Sequence:CCGGGACTTCAAGAGATATTGCTTTCTCGAGAAAGCAATATCTCTTGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176999.2-399s1c1
Sequence:CCGGCCTGGTGATTCTGAACTGGATCTCGAGATCCAGTTCAGAATCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)