EMAIL THIS PAGE TO A FRIEND

ATP10D

ATPase, class V, type 10D

121 Gene Product Result for
Synonyms: ATPVD
UniProtKB ID: Q9P241, A2RRC8, D6REN2, Q8NC70, Q96SR3
Gene ID:
Mouse(231287) ATPase, class V, type 10D
Rat(360932) ATPase, class V, type 10D
Zebrafish(571658) ATPase, class V, type 10D
cow(536495) ATPase, class V, type 10D
Horse(100061624) ATPase, class V, type 10D
domestic cat(101097392) ATPase, class V, type 10D
chicken(422768) ATPase, class V, type 10D
dog(482134) ATPase, class V, type 10D
sheep(101122863) ATPase, class V, type 10D
Domestic Rabbit(100356348) ATPase, class V, type 10D
naked mole-rat(101716149) ATPase, class V, type 10D
domestic guinea pig(100719792) ATPase, class V, type 10D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153389 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153389 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153389 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020453 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020453 Rosetta Predictions human pricing
XM_341209 Rosetta Predictions rat pricing
XR_009136 Rosetta Predictions rat pricing
NM_153389 Rosetta Predictions mouse pricing
NR_003966 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069039 predicted 988
2 SASI_Hs02_00353491 predicted 3736
3 SASI_Hs01_00069040 predicted 772
4 SASI_Hs02_00353492 predicted 1509
5 SASI_Hs01_00069041 predicted 1120
6 SASI_Hs01_00069042 predicted 2662
7 SASI_Hs01_00069043 predicted 1786
8 SASI_Hs01_00069044 predicted 1128
9 SASI_Hs01_00069045 predicted 335
10 SASI_Hs01_00069046 predicted 1321
11 SASI_Hs01_00069047 predicted 4256
12 SASI_Hs01_00069048 predicted 2393
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392583 predicted 3395
2 SASI_Rn02_00392584 predicted 2156
3 SASI_Rn02_00392585 predicted 1185
4 SASI_Rn02_00392586 predicted 2927
5 SASI_Rn02_00392587 predicted 1388
6 SASI_Rn02_00392588 predicted 3477
7 SASI_Rn02_00392589 predicted 2883
8 SASI_Rn02_00392590 predicted 2417
9 SASI_Rn02_00392591 predicted 1896
10 SASI_Rn02_00392592 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00141674 predicted 3415
2 SASI_Rn01_00141675 predicted 2176
3 SASI_Rn01_00141676 predicted 5528
4 SASI_Rn01_00141677 predicted 4373
5 SASI_Rn01_00141678 predicted 2938
6 SASI_Rn01_00141679 predicted 5646
7 SASI_Rn02_00418867 predicted 3489
8 SASI_Rn02_00418868 predicted 2896
9 SASI_Rn01_00141680 predicted 2438
10 SASI_Rn01_00141681 predicted 1912
11 SASI_Rn01_00141682 predicted 881
12 SASI_Rn01_00141683 predicted 5546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029250 predicted 2905
2 SASI_Mm02_00343164 predicted 1624
3 SASI_Mm01_00029252 predicted 2785
4 SASI_Mm01_00029253 predicted 1293
5 SASI_Mm01_00029254 predicted 1275
6 SASI_Mm01_00029255 predicted 1177
7 SASI_Mm01_00029256 predicted 397
8 SASI_Mm01_00029257 predicted 324
9 SASI_Mm01_00029258 predicted 4340
10 SASI_Mm01_00029259 predicted 551
11 SASI_Mm01_00029251 predicted 2472
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003966 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00353989 predicted 2918
2 SASI_Mm02_00353990 predicted 5285
3 SASI_Mm02_00353991 predicted 2799
4 SASI_Mm02_00353992 predicted 1308
5 SASI_Mm02_00353993 predicted 1285
6 SASI_Mm02_00353994 predicted 1193
7 SASI_Mm02_00353995 predicted 4655
8 SASI_Mm02_00353996 predicted 409
9 SASI_Mm02_00353997 predicted 337
10 SASI_Mm02_00353998 predicted 5354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153389
ATP10D MISSION shRNA Bacterial Glycerol Stock
ATPase, class V, type 10D
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153389.2-4711s1c1
Sequence:CCGGGCAGAGTTTAGGAACTGGAATCTCGAGATTCCAGTTCCTAAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153389.2-4186s1c1
Sequence:CCGGCCGAGGTTTCTTTACCGAGTTCTCGAGAACTCGGTAAAGAAACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153389.2-2769s1c1
Sequence:CCGGGCGCACTCTATGTGTAGCAAACTCGAGTTTGCTACACATAGAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153389.2-1624s1c1
Sequence:CCGGGCAGGGTTTGACTACTGTCATCTCGAGATGACAGTAGTCAAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153389.2-434s1c1
Sequence:CCGGGCTTCAAAGATGAGTACGAAACTCGAGTTTCGTACTCATCTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153389.3-401s21c1
Sequence:CCGGGAAAGCACCGCGTCGTTATTCCTCGAGGAATAACGACGCGGTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153389.3-1442s21c1
Sequence:CCGGTGAAGCTTGGGCAGATCTATTCTCGAGAATAGATCTGCCCAAGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153389
ATP10D MISSION shRNA shRNA Plasmid DNA
ATPase, class V, type 10D
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153389.2-4711s1c1
Sequence:CCGGGCAGAGTTTAGGAACTGGAATCTCGAGATTCCAGTTCCTAAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153389.2-4186s1c1
Sequence:CCGGCCGAGGTTTCTTTACCGAGTTCTCGAGAACTCGGTAAAGAAACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153389.2-2769s1c1
Sequence:CCGGGCGCACTCTATGTGTAGCAAACTCGAGTTTGCTACACATAGAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153389.2-1624s1c1
Sequence:CCGGGCAGGGTTTGACTACTGTCATCTCGAGATGACAGTAGTCAAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153389.2-434s1c1
Sequence:CCGGGCTTCAAAGATGAGTACGAAACTCGAGTTTCGTACTCATCTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153389.3-401s21c1
Sequence:CCGGGAAAGCACCGCGTCGTTATTCCTCGAGGAATAACGACGCGGTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153389.3-1442s21c1
Sequence:CCGGTGAAGCTTGGGCAGATCTATTCTCGAGAATAGATCTGCCCAAGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153389
ATP10D MISSION shRNA Lentiviral Transduction Particles
ATPase, class V, type 10D
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153389.2-4711s1c1
Sequence:CCGGGCAGAGTTTAGGAACTGGAATCTCGAGATTCCAGTTCCTAAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153389.2-4186s1c1
Sequence:CCGGCCGAGGTTTCTTTACCGAGTTCTCGAGAACTCGGTAAAGAAACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153389.2-2769s1c1
Sequence:CCGGGCGCACTCTATGTGTAGCAAACTCGAGTTTGCTACACATAGAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153389.2-1624s1c1
Sequence:CCGGGCAGGGTTTGACTACTGTCATCTCGAGATGACAGTAGTCAAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153389.2-434s1c1
Sequence:CCGGGCTTCAAAGATGAGTACGAAACTCGAGTTTCGTACTCATCTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153389.3-401s21c1
Sequence:CCGGGAAAGCACCGCGTCGTTATTCCTCGAGGAATAACGACGCGGTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153389.3-1442s21c1
Sequence:CCGGTGAAGCTTGGGCAGATCTATTCTCGAGAATAGATCTGCCCAAGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020453
ATP10D MISSION shRNA Bacterial Glycerol Stock
ATPase, class V, type 10D
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020453.2-1857s1c1
Sequence:CCGGCGGCTCTTTATGCCACTAGATCTCGAGATCTAGTGGCATAAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020453.2-3426s1c1
Sequence:CCGGGCCGTTTATCAGTTCAAACATCTCGAGATGTTTGAACTGATAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020453.2-2474s1c1
Sequence:CCGGGCCCTTTGACTCAGTAAGAAACTCGAGTTTCTTACTGAGTCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020453.2-580s1c1
Sequence:CCGGGCCTGGAAGGTTATCGGAAATCTCGAGATTTCCGATAACCTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020453.2-372s1c1
Sequence:CCGGGCCTATGTGAACAATCGAATACTCGAGTATTCGATTGTTCACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020453.3-4813s21c1
Sequence:CCGGGTCAGGCTCCAGTCGGAATTTCTCGAGAAATTCCGACTGGAGCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020453.3-1326s21c1
Sequence:CCGGCTCTATGTTTCCATCGAAATTCTCGAGAATTTCGATGGAAACATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020453
ATP10D MISSION shRNA shRNA Plasmid DNA
ATPase, class V, type 10D
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020453.2-1857s1c1
Sequence:CCGGCGGCTCTTTATGCCACTAGATCTCGAGATCTAGTGGCATAAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020453.2-3426s1c1
Sequence:CCGGGCCGTTTATCAGTTCAAACATCTCGAGATGTTTGAACTGATAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020453.2-2474s1c1
Sequence:CCGGGCCCTTTGACTCAGTAAGAAACTCGAGTTTCTTACTGAGTCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020453.2-580s1c1
Sequence:CCGGGCCTGGAAGGTTATCGGAAATCTCGAGATTTCCGATAACCTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020453.2-372s1c1
Sequence:CCGGGCCTATGTGAACAATCGAATACTCGAGTATTCGATTGTTCACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020453.3-4813s21c1
Sequence:CCGGGTCAGGCTCCAGTCGGAATTTCTCGAGAAATTCCGACTGGAGCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020453.3-1326s21c1
Sequence:CCGGCTCTATGTTTCCATCGAAATTCTCGAGAATTTCGATGGAAACATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020453
ATP10D MISSION shRNA Lentiviral Transduction Particles
ATPase, class V, type 10D
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020453.2-1857s1c1
Sequence:CCGGCGGCTCTTTATGCCACTAGATCTCGAGATCTAGTGGCATAAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020453.2-3426s1c1
Sequence:CCGGGCCGTTTATCAGTTCAAACATCTCGAGATGTTTGAACTGATAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020453.2-2474s1c1
Sequence:CCGGGCCCTTTGACTCAGTAAGAAACTCGAGTTTCTTACTGAGTCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020453.2-580s1c1
Sequence:CCGGGCCTGGAAGGTTATCGGAAATCTCGAGATTTCCGATAACCTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020453.2-372s1c1
Sequence:CCGGGCCTATGTGAACAATCGAATACTCGAGTATTCGATTGTTCACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020453.3-4813s21c1
Sequence:CCGGGTCAGGCTCCAGTCGGAATTTCTCGAGAAATTCCGACTGGAGCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020453.3-1326s21c1
Sequence:CCGGCTCTATGTTTCCATCGAAATTCTCGAGAATTTCGATGGAAACATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks