EMAIL THIS PAGE TO A FRIEND

ATP11A

ATPase, class VI, type 11A

Synonyms: ATPIH ATPIS
UniProtKB ID: P98196, Q5VXT2
Gene ID:
Human(23250) Summary: The protein encoded by this gene is an integral membrane ATPase. The encoded protein is probably phosphorylated in its intermediate state and likely drives the transport of ions such as calcium across membranes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(50770) ATPase, class VI, type 11A
Rat(306600) ATPase, class VI, type 11A
domestic guinea pig(100728177) ATPase, class VI, type 11A
naked mole-rat(101710735) ATPase, class VI, type 11A
sheep(101117857) ATPase, class VI, type 11A
Domestic Rabbit(100342686) ATPase, class VI, type 11A
Zebrafish(562925) ATPase, class VI, type 11A
cow(512547) ATPase, class VI, type 11A
Horse(100066940) ATPase, class VI, type 11A
domestic cat(101097781) ATPase, class VI, type 11A
dog(476992) ATPase, class VI, type 11A
chicken(418749) ATPase, class VI, type 11A
155 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015205 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015205 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015205 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_495964 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_495964 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_495964 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061691 MISSION® esiRNA esiRNA human ATP11A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015205 Rosetta Predictions human pricing
NM_032189 Rosetta Predictions human pricing
NM_001107324 Rosetta Predictions rat pricing
NM_015804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106358 predicted 1898
2 SASI_Hs01_00106359 predicted 2123
3 SASI_Hs01_00106360 predicted 418
4 SASI_Hs01_00106362 predicted 978
5 SASI_Hs01_00106363 predicted 2813
6 SASI_Hs01_00106364 predicted 3064
7 SASI_Hs01_00106365 predicted 1303
8 SASI_Hs01_00106366 predicted 2831
9 SASI_Hs01_00106367 predicted 1172
10 SASI_Hs02_00347302 predicted 3134
11 SASI_Hs01_00106361 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111774 predicted 1903
2 SASI_Hs01_00111775 predicted 2117
3 SASI_Hs01_00111776 predicted 414
4 SASI_Hs01_00111778 predicted 977
5 SASI_Hs01_00111779 predicted 2811
6 SASI_Hs01_00111780 predicted 3057
7 SASI_Hs01_00111781 predicted 1308
8 SASI_Hs01_00111782 predicted 2824
9 SASI_Hs01_00111783 predicted 1166
10 SASI_Hs02_00359473 predicted 3134
11 SASI_Hs01_00111777 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107324 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227715 predicted 633
2 SASI_Rn02_00227716 predicted 1935
3 SASI_Rn02_00227717 predicted 3054
4 SASI_Rn02_00227718 predicted 2941
5 SASI_Rn02_00227719 predicted 1855
6 SASI_Rn02_00227720 predicted 1381
7 SASI_Rn02_00227721 predicted 3775
8 SASI_Rn02_00227722 predicted 1379
9 SASI_Rn02_00227723 predicted 1131
10 SASI_Rn02_00227724 predicted 3280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055085 predicted 1928
2 SASI_Mm02_00323186 predicted 1956
3 SASI_Mm01_00055086 predicted 1979
4 SASI_Mm01_00055087 predicted 2302
5 SASI_Mm01_00055088 predicted 2936
6 SASI_Mm01_00055089 predicted 1124
7 SASI_Mm01_00055090 predicted 3059
8 SASI_Mm01_00055091 predicted 3028
9 SASI_Mm02_00323187 predicted 2764
10 SASI_Mm01_00055092 predicted 1381
11 SASI_Mm01_00055093 predicted 2673
12 SASI_Mm01_00055094 predicted 288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015205
ATP11A MISSION shRNA Bacterial Glycerol Stock
ATPase, class VI, type 11A
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000419937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015205.2-2344s21c1
Sequence:CCGGTATGCAGGACTACGGTTTAATCTCGAGATTAAACCGTAGTCCTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015205.2-1816s21c1
Sequence:CCGGAGGAGCAGATTCTTCGATATTCTCGAGAATATCGAAGAATCTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015205
ATP11A MISSION shRNA shRNA Plasmid DNA
ATPase, class VI, type 11A
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000419937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015205.2-2344s21c1
Sequence:CCGGTATGCAGGACTACGGTTTAATCTCGAGATTAAACCGTAGTCCTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015205.2-1816s21c1
Sequence:CCGGAGGAGCAGATTCTTCGATATTCTCGAGAATATCGAAGAATCTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015205
ATP11A MISSION shRNA Lentiviral Transduction Particles
ATPase, class VI, type 11A
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000419937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015205.2-2344s21c1
Sequence:CCGGTATGCAGGACTACGGTTTAATCTCGAGATTAAACCGTAGTCCTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015205.2-1816s21c1
Sequence:CCGGAGGAGCAGATTCTTCGATATTCTCGAGAATATCGAAGAATCTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_495964
VALIDATED
ATP11A MISSION shRNA Bacterial Glycerol Stock
ATPase, class VI, type 11A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_495964.1-2766s1c1
Sequence:CCGGGCACGATAATTTGCTACACTTCTCGAGAAGTGTAGCAAATTATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_495964.1-150s1c1
Sequence:CCGGGCTGCTGTTCTACGTTGTCTTCTCGAGAAGACAACGTAGAACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:XM_495964.1-42s1c1
Sequence:CCGGGACGTTTGGAACGCTGGTATTCTCGAGAATACCAGCGTTCCAAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:XM_495964.1-346s1c1
Sequence:CCGGGCAACAGAGAGAGTCCAGAATCTCGAGATTCTGGACTCTCTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:XM_495964.1-213s1c1
Sequence:CCGGCCAGAGGATGTACTACGTGTTCTCGAGAACACGTAGTACATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_495964
VALIDATED
ATP11A MISSION shRNA shRNA Plasmid DNA
ATPase, class VI, type 11A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_495964.1-2766s1c1
Sequence:CCGGGCACGATAATTTGCTACACTTCTCGAGAAGTGTAGCAAATTATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_495964.1-150s1c1
Sequence:CCGGGCTGCTGTTCTACGTTGTCTTCTCGAGAAGACAACGTAGAACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:XM_495964.1-42s1c1
Sequence:CCGGGACGTTTGGAACGCTGGTATTCTCGAGAATACCAGCGTTCCAAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:XM_495964.1-346s1c1
Sequence:CCGGGCAACAGAGAGAGTCCAGAATCTCGAGATTCTGGACTCTCTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:XM_495964.1-213s1c1
Sequence:CCGGCCAGAGGATGTACTACGTGTTCTCGAGAACACGTAGTACATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_495964
VALIDATED
ATP11A MISSION shRNA Lentiviral Transduction Particles
ATPase, class VI, type 11A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_495964.1-2766s1c1
Sequence:CCGGGCACGATAATTTGCTACACTTCTCGAGAAGTGTAGCAAATTATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_495964.1-150s1c1
Sequence:CCGGGCTGCTGTTCTACGTTGTCTTCTCGAGAAGACAACGTAGAACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:XM_495964.1-42s1c1
Sequence:CCGGGACGTTTGGAACGCTGGTATTCTCGAGAATACCAGCGTTCCAAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:XM_495964.1-346s1c1
Sequence:CCGGGCAACAGAGAGAGTCCAGAATCTCGAGATTCTGGACTCTCTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:XM_495964.1-213s1c1
Sequence:CCGGCCAGAGGATGTACTACGTGTTCTCGAGAACACGTAGTACATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015804
ATP11A MISSION shRNA Bacterial Glycerol Stock
ATPase, class VI, type 11A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015804.1-2547s1c1
Sequence:CCGGGCATCCTATTACCTTAGCAATCTCGAGATTGCTAAGGTAATAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015804.1-3276s1c1
Sequence:CCGGCCAGAGGATGTACTATGTGTTCTCGAGAACACATAGTACATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015804.1-2514s1c1
Sequence:CCGGCCAGATCGTTAAGTTAATCAACTCGAGTTGATTAACTTAACGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015804.1-1849s1c1
Sequence:CCGGCGAGTGATAGAAGGCAAAGTACTCGAGTACTTTGCCTTCTATCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015804.1-1751s1c1
Sequence:CCGGCCTTTGATTCTGTGCGGAGAACTCGAGTTCTCCGCACAGAATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015804
ATP11A MISSION shRNA shRNA Plasmid DNA
ATPase, class VI, type 11A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015804.1-2547s1c1
Sequence:CCGGGCATCCTATTACCTTAGCAATCTCGAGATTGCTAAGGTAATAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015804.1-3276s1c1
Sequence:CCGGCCAGAGGATGTACTATGTGTTCTCGAGAACACATAGTACATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015804.1-2514s1c1
Sequence:CCGGCCAGATCGTTAAGTTAATCAACTCGAGTTGATTAACTTAACGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015804.1-1849s1c1
Sequence:CCGGCGAGTGATAGAAGGCAAAGTACTCGAGTACTTTGCCTTCTATCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015804.1-1751s1c1
Sequence:CCGGCCTTTGATTCTGTGCGGAGAACTCGAGTTCTCCGCACAGAATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015804
ATP11A MISSION shRNA Lentiviral Transduction Particles
ATPase, class VI, type 11A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015804.1-2547s1c1
Sequence:CCGGGCATCCTATTACCTTAGCAATCTCGAGATTGCTAAGGTAATAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015804.1-3276s1c1
Sequence:CCGGCCAGAGGATGTACTATGTGTTCTCGAGAACACATAGTACATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015804.1-2514s1c1
Sequence:CCGGCCAGATCGTTAAGTTAATCAACTCGAGTTGATTAACTTAACGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015804.1-1849s1c1
Sequence:CCGGCGAGTGATAGAAGGCAAAGTACTCGAGTACTTTGCCTTCTATCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015804.1-1751s1c1
Sequence:CCGGCCTTTGATTCTGTGCGGAGAACTCGAGTTCTCCGCACAGAATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks