EMAIL THIS PAGE TO A FRIEND

ATP11B

ATPase, class VI, type 11B

122 Gene Product Result for
Synonyms: ATPIF ATPIR
UniProtKB ID: Q9Y2G3, Q96FN1, Q9UKK7
Gene ID:
Human(23200) Summary: P-type ATPases, such as ATP11B, are phosphorylated in their intermediate state and drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily transports heavy metal ions, such as Cu(2+) or Cd(2+). Another subfamily transports non-heavy metal ions, such as H(+), Na(+), K(+), or Ca(+). A third subfamily transports amphipaths, such as phosphatidylserine.[supplied by OMIM, Feb 2005]
Mouse(76295) ATPase, class VI, type 11B
Rat(361929) ATPase, class VI, type 11B
Zebrafish(100317301) ATPase, class VI, type 11B
cow(614392) ATPase, class VI, type 11B
domestic cat(101099649) ATPase, class VI, type 11B
dog(478644) ATPase, class VI, type 11B
chicken(424964) ATPase, class VI, type 11B
sheep(101110296) ATPase, class VI, type 11B
Domestic Rabbit(100008757) ATPase, class VI, type 11B
naked mole-rat(101725306) ATPase, class VI, type 11B
domestic guinea pig(100725682) ATPase, class VI, type 11B
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029570 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029570 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029570 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_087254 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_087254 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_087254 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014616 Rosetta Predictions human pricing
XM_001067830 Rosetta Predictions rat pricing
XM_342228 Rosetta Predictions rat pricing
NM_029570 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045762 predicted 1960
2 SASI_Hs01_00045764 predicted 749
3 SASI_Hs02_00345905 predicted 2048
4 SASI_Hs01_00045765 predicted 2289
5 SASI_Hs01_00045766 predicted 2335
6 SASI_Hs01_00045767 predicted 611
7 SASI_Hs02_00345906 predicted 2303
8 SASI_Hs01_00045771 predicted 3253
9 SASI_Hs02_00345907 predicted 938
10 SASI_Hs02_00345908 predicted 615
11 SASI_Hs01_00045763 predicted 3595
12 SASI_Hs01_00045768 predicted 3840
13 SASI_Hs01_00045769 predicted 2124
14 SASI_Hs01_00045770 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067830 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322463 predicted 3731
2 SASI_Rn02_00322464 predicted 1381
3 SASI_Rn02_00322465 predicted 3147
4 SASI_Rn02_00322466 predicted 1853
5 SASI_Rn02_00322467 predicted 2210
6 SASI_Rn02_00322468 predicted 2879
7 SASI_Rn02_00322469 predicted 2069
8 SASI_Rn02_00322470 predicted 2036
9 SASI_Rn02_00322471 predicted 2174
10 SASI_Rn02_00322472 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393956 predicted 3058
2 SASI_Rn02_00393957 predicted 697
3 SASI_Rn02_00393958 predicted 529
4 SASI_Rn02_00393959 predicted 2467
5 SASI_Rn02_00393960 predicted 1166
6 SASI_Rn02_00393961 predicted 1534
7 SASI_Rn02_00393962 predicted 2193
8 SASI_Rn02_00393963 predicted 1390
9 SASI_Rn02_00393964 predicted 1361
10 SASI_Rn02_00393965 predicted 1490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029570 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335518 predicted 3726
2 SASI_Mm02_00335519 predicted 290
3 SASI_Mm01_00152195 predicted 304
4 SASI_Mm02_00335520 predicted 1330
5 SASI_Mm01_00152196 predicted 2601
6 SASI_Mm01_00152197 predicted 3753
7 SASI_Mm01_00152199 predicted 1498
8 SASI_Mm01_00152200 predicted 3713
9 SASI_Mm01_00152202 predicted 1030
10 SASI_Mm01_00152203 predicted 1807
11 SASI_Mm01_00152194 predicted 2375
12 SASI_Mm01_00152198 predicted 1528
13 SASI_Mm01_00152201 predicted 3678
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029570
VALIDATED
ATP11B MISSION shRNA Bacterial Glycerol Stock
ATPase, class VI, type 11B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029570.3-341s1c1
Sequence:CCGGGCCTTTACACACCTCAGAAATCTCGAGATTTCTGAGGTGTGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029570.3-2212s1c1
Sequence:CCGGCGGGAAGAGAAATTGGCTGATCTCGAGATCAGCCAATTTCTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029570.3-1969s1c1
Sequence:CCGGCGTAGGAGAATGAGTGTAATTCTCGAGAATTACACTCATTCTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029570.3-4458s1c1
Sequence:CCGGGCCATTTACTAGACTTCAAATCTCGAGATTTGAAGTCTAGTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029570.3-841s1c1
Sequence:CCGGGCCAACTTGGACAGTCTCATACTCGAGTATGAGACTGTCCAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029570.3-4168s21c1
Sequence:CCGGTTTGCCTTGAGAACTCTATTTCTCGAGAAATAGAGTTCTCAAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029570.3-841s21c1
Sequence:CCGGGCCAACTTGGACAGTCTCATACTCGAGTATGAGACTGTCCAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029570.3-975s21c1
Sequence:CCGGGCTTCGTGGAGCCAGATTAAACTCGAGTTTAATCTGGCTCCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029570.3-1969s21c1
Sequence:CCGGCGTAGGAGAATGAGTGTAATTCTCGAGAATTACACTCATTCTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029570.3-1854s21c1
Sequence:CCGGTGCGGCAAGAGCTGGTATTATCTCGAGATAATACCAGCTCTTGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029570
VALIDATED
ATP11B MISSION shRNA shRNA Plasmid DNA
ATPase, class VI, type 11B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029570.3-341s1c1
Sequence:CCGGGCCTTTACACACCTCAGAAATCTCGAGATTTCTGAGGTGTGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029570.3-2212s1c1
Sequence:CCGGCGGGAAGAGAAATTGGCTGATCTCGAGATCAGCCAATTTCTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029570.3-1969s1c1
Sequence:CCGGCGTAGGAGAATGAGTGTAATTCTCGAGAATTACACTCATTCTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029570.3-4458s1c1
Sequence:CCGGGCCATTTACTAGACTTCAAATCTCGAGATTTGAAGTCTAGTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029570.3-841s1c1
Sequence:CCGGGCCAACTTGGACAGTCTCATACTCGAGTATGAGACTGTCCAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029570.3-4168s21c1
Sequence:CCGGTTTGCCTTGAGAACTCTATTTCTCGAGAAATAGAGTTCTCAAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029570.3-841s21c1
Sequence:CCGGGCCAACTTGGACAGTCTCATACTCGAGTATGAGACTGTCCAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029570.3-975s21c1
Sequence:CCGGGCTTCGTGGAGCCAGATTAAACTCGAGTTTAATCTGGCTCCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029570.3-1969s21c1
Sequence:CCGGCGTAGGAGAATGAGTGTAATTCTCGAGAATTACACTCATTCTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029570.3-1854s21c1
Sequence:CCGGTGCGGCAAGAGCTGGTATTATCTCGAGATAATACCAGCTCTTGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029570
VALIDATED
ATP11B MISSION shRNA Lentiviral Transduction Particles
ATPase, class VI, type 11B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029570.3-341s1c1
Sequence:CCGGGCCTTTACACACCTCAGAAATCTCGAGATTTCTGAGGTGTGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029570.3-2212s1c1
Sequence:CCGGCGGGAAGAGAAATTGGCTGATCTCGAGATCAGCCAATTTCTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029570.3-1969s1c1
Sequence:CCGGCGTAGGAGAATGAGTGTAATTCTCGAGAATTACACTCATTCTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029570.3-4458s1c1
Sequence:CCGGGCCATTTACTAGACTTCAAATCTCGAGATTTGAAGTCTAGTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029570.3-841s1c1
Sequence:CCGGGCCAACTTGGACAGTCTCATACTCGAGTATGAGACTGTCCAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029570.3-4168s21c1
Sequence:CCGGTTTGCCTTGAGAACTCTATTTCTCGAGAAATAGAGTTCTCAAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029570.3-841s21c1
Sequence:CCGGGCCAACTTGGACAGTCTCATACTCGAGTATGAGACTGTCCAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029570.3-975s21c1
Sequence:CCGGGCTTCGTGGAGCCAGATTAAACTCGAGTTTAATCTGGCTCCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029570.3-1969s21c1
Sequence:CCGGCGTAGGAGAATGAGTGTAATTCTCGAGAATTACACTCATTCTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029570.3-1854s21c1
Sequence:CCGGTGCGGCAAGAGCTGGTATTATCTCGAGATAATACCAGCTCTTGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_087254
VALIDATED
ATP11B MISSION shRNA Bacterial Glycerol Stock
ATPase, class VI, type 11B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_087254.4-1435s1c1
Sequence:CCGGCGGTACAAACTGCTTCATATTCTCGAGAATATGAAGCAGTTTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087254.4-1555s1c1
Sequence:CCGGCCTAAATGTATAGGTGGAGAACTCGAGTTCTCCACCTATACATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_087254.4-2579s1c1
Sequence:CCGGCCACCCTTTATCGAGACATTACTCGAGTAATGTCTCGATAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087254.4-526s1c1
Sequence:CCGGGCTGTAATAGAATGCCAGCAACTCGAGTTGCTGGCATTCTATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087254.4-2284s1c1
Sequence:CCGGGCTGCAAGAAACAGTGACTATCTCGAGATAGTCACTGTTTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_087254
VALIDATED
ATP11B MISSION shRNA shRNA Plasmid DNA
ATPase, class VI, type 11B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_087254.4-1435s1c1
Sequence:CCGGCGGTACAAACTGCTTCATATTCTCGAGAATATGAAGCAGTTTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087254.4-1555s1c1
Sequence:CCGGCCTAAATGTATAGGTGGAGAACTCGAGTTCTCCACCTATACATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_087254.4-2579s1c1
Sequence:CCGGCCACCCTTTATCGAGACATTACTCGAGTAATGTCTCGATAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087254.4-526s1c1
Sequence:CCGGGCTGTAATAGAATGCCAGCAACTCGAGTTGCTGGCATTCTATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087254.4-2284s1c1
Sequence:CCGGGCTGCAAGAAACAGTGACTATCTCGAGATAGTCACTGTTTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_087254
VALIDATED
ATP11B MISSION shRNA Lentiviral Transduction Particles
ATPase, class VI, type 11B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_087254.4-1435s1c1
Sequence:CCGGCGGTACAAACTGCTTCATATTCTCGAGAATATGAAGCAGTTTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087254.4-1555s1c1
Sequence:CCGGCCTAAATGTATAGGTGGAGAACTCGAGTTCTCCACCTATACATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_087254.4-2579s1c1
Sequence:CCGGCCACCCTTTATCGAGACATTACTCGAGTAATGTCTCGATAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087254.4-526s1c1
Sequence:CCGGGCTGTAATAGAATGCCAGCAACTCGAGTTGCTGGCATTCTATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087254.4-2284s1c1
Sequence:CCGGGCTGCAAGAAACAGTGACTATCTCGAGATAGTCACTGTTTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks