EMAIL THIS PAGE TO A FRIEND

ATP11C

ATPase, class VI, type 11C

221 Gene Product Result for
Synonyms: ATPIG ATPIQ
Gene ID:
Mouse(320940) ATPase, class VI, type 11C
Rat(317599) ATPase, class VI, type 11C
domestic guinea pig(100715110) ATPase, class VI, type 11C
naked mole-rat(101721324) ATPase, class VI, type 11C
sheep(101122839) ATPase, class VI, type 11C
Domestic Rabbit(100346151) ATPase, class VI, type 11C
Zebrafish(368385) ATPase, Class VI, type 11C
dog(481066) ATPase, class VI, type 11C
domestic cat(101099786) ATPase, class VI, type 11C
Horse(100055432) ATPase, class VI, type 11C
cow(529689) ATPase, class VI, type 11C
cow(504969) ATPase, class VI, type 11C
chicken(422254) ATPase, class VI, type 11C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001798 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001798 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001798 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173694 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010986 Rosetta Predictions human pricing
NM_173694 Rosetta Predictions human pricing
XM_229173 Rosetta Predictions rat pricing
XR_007360 Rosetta Predictions rat pricing
NM_001001798 Rosetta Predictions mouse pricing
NM_001037863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171919 predicted 1386
2 SASI_Hs01_00171920 predicted 1176
3 SASI_Hs01_00171921 predicted 1055
4 SASI_Hs01_00171922 predicted 2146
5 SASI_Hs01_00171924 predicted 644
6 SASI_Hs01_00171925 predicted 662
7 SASI_Hs01_00171926 predicted 841
8 SASI_Hs02_00305957 predicted 1015
9 SASI_Hs01_00171927 predicted 758
10 SASI_Hs02_00305958 predicted 2055
11 SASI_Hs01_00171923 predicted 2812
12 SASI_Hs01_00171928 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117688 predicted 1391
2 SASI_Hs01_00117689 predicted 1172
3 SASI_Hs01_00117690 predicted 1053
4 SASI_Hs01_00117691 predicted 2140
5 SASI_Hs01_00117693 predicted 643
6 SASI_Hs01_00117694 predicted 655
7 SASI_Hs01_00117695 predicted 841
8 SASI_Hs02_00368637 predicted 1017
9 SASI_Hs01_00117696 predicted 760
10 SASI_Hs02_00368638 predicted 2059
11 SASI_Hs01_00117692 predicted 2818
12 SASI_Hs01_00117697 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_229173 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00193385 predicted 3346
2 SASI_Rn01_00193386 predicted 3065
3 SASI_Rn01_00193387 predicted 2708
4 SASI_Rn01_00193388 predicted 2392
5 SASI_Rn01_00193389 predicted 2694
6 SASI_Rn01_00193390 predicted 2982
7 SASI_Rn01_00193391 predicted 3345
8 SASI_Rn01_00193392 predicted 2812
9 SASI_Rn01_00193393 predicted 2742
10 SASI_Rn01_00193394 predicted 3304
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00414368 predicted 3809
2 SASI_Rn01_00160668 predicted 1770
3 SASI_Rn02_00414369 predicted 5479
4 SASI_Rn01_00160672 predicted 2736
5 SASI_Rn01_00160675 predicted 3372
6 SASI_Rn02_00414370 predicted 5158
7 SASI_Rn01_00160676 predicted 2838
8 SASI_Rn02_00414371 predicted 4511
9 SASI_Rn02_00414372 predicted 3979
10 SASI_Rn02_00414373 predicted 3515
11 SASI_Rn01_00160669 predicted 2039
12 SASI_Rn01_00160670 predicted 3390
13 SASI_Rn01_00160671 predicted 277
14 SASI_Rn01_00160673 predicted 811
15 SASI_Rn01_00160674 predicted 714
16 SASI_Rn01_00160677 predicted 2370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162497 predicted 2853
2 SASI_Mm01_00162499 predicted 2044
3 SASI_Mm01_00162500 predicted 2288
4 SASI_Mm01_00162501 predicted 2752
5 SASI_Mm01_00162502 predicted 2428
6 SASI_Mm01_00162503 predicted 703
7 SASI_Mm01_00162504 predicted 1890
8 SASI_Mm02_00286208 predicted 3017
9 SASI_Mm01_00162506 predicted 206
10 SASI_Mm02_00286209 predicted 2933
11 SASI_Mm01_00162498 predicted 821
12 SASI_Mm01_00162505 predicted 2285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155103 predicted 2855
2 SASI_Mm01_00155105 predicted 2051
3 SASI_Mm01_00155106 predicted 2285
4 SASI_Mm01_00155107 predicted 2745
5 SASI_Mm01_00155108 predicted 2432
6 SASI_Mm01_00155109 predicted 700
7 SASI_Mm01_00155110 predicted 1884
8 SASI_Mm02_00289477 predicted 3026
9 SASI_Mm01_00155112 predicted 202
10 SASI_Mm02_00289478 predicted 2933
11 SASI_Mm01_00155104 predicted 827
12 SASI_Mm01_00155111 predicted 2284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001798
VALIDATED
ATP11C MISSION shRNA Bacterial Glycerol Stock
ATPase, class VI, type 11C
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000449216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001798.2-237s21c1
Sequence:CCGGTTCTGGAACAGAACCTTATATCTCGAGATATAAGGTTCTGTTCCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001798.2-3636s21c1
Sequence:CCGGAGTTATTGTAAGTAGCCATTACTCGAGTAATGGCTACTTACAATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001798.1-1863s1c1
Sequence:CCGGCCAGGGTACATAGCCATCAAACTCGAGTTTGATGGCTATGTACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001798.1-3457s1c1
Sequence:CCGGGCCTATGTTATTGTCCTACAACTCGAGTTGTAGGACAATAACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001798.1-2318s1c1
Sequence:CCGGCGTAAGAAGTTGCTGCATGAACTCGAGTTCATGCAGCAACTTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001798.1-3389s1c1
Sequence:CCGGCCTGAGATTCTCCTAATAGTTCTCGAGAACTATTAGGAGAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001798.1-962s1c1
Sequence:CCGGGCTTTGAACTACCAAGGGAAACTCGAGTTTCCCTTGGTAGTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001798
VALIDATED
ATP11C MISSION shRNA shRNA Plasmid DNA
ATPase, class VI, type 11C
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000449216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001798.2-237s21c1
Sequence:CCGGTTCTGGAACAGAACCTTATATCTCGAGATATAAGGTTCTGTTCCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001798.2-3636s21c1
Sequence:CCGGAGTTATTGTAAGTAGCCATTACTCGAGTAATGGCTACTTACAATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001798.1-1863s1c1
Sequence:CCGGCCAGGGTACATAGCCATCAAACTCGAGTTTGATGGCTATGTACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001798.1-3457s1c1
Sequence:CCGGGCCTATGTTATTGTCCTACAACTCGAGTTGTAGGACAATAACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001798.1-2318s1c1
Sequence:CCGGCGTAAGAAGTTGCTGCATGAACTCGAGTTCATGCAGCAACTTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001798.1-3389s1c1
Sequence:CCGGCCTGAGATTCTCCTAATAGTTCTCGAGAACTATTAGGAGAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001798.1-962s1c1
Sequence:CCGGGCTTTGAACTACCAAGGGAAACTCGAGTTTCCCTTGGTAGTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001798
VALIDATED
ATP11C MISSION shRNA Lentiviral Transduction Particles
ATPase, class VI, type 11C
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000449216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001798.2-237s21c1
Sequence:CCGGTTCTGGAACAGAACCTTATATCTCGAGATATAAGGTTCTGTTCCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001798.2-3636s21c1
Sequence:CCGGAGTTATTGTAAGTAGCCATTACTCGAGTAATGGCTACTTACAATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001798.1-1863s1c1
Sequence:CCGGCCAGGGTACATAGCCATCAAACTCGAGTTTGATGGCTATGTACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001798.1-3457s1c1
Sequence:CCGGGCCTATGTTATTGTCCTACAACTCGAGTTGTAGGACAATAACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001798.1-2318s1c1
Sequence:CCGGCGTAAGAAGTTGCTGCATGAACTCGAGTTCATGCAGCAACTTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001798.1-3389s1c1
Sequence:CCGGCCTGAGATTCTCCTAATAGTTCTCGAGAACTATTAGGAGAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001798.1-962s1c1
Sequence:CCGGGCTTTGAACTACCAAGGGAAACTCGAGTTTCCCTTGGTAGTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173694
ATP11C MISSION shRNA Bacterial Glycerol Stock
ATPase, class VI, type 11C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173694.2-5478s1c1
Sequence:CCGGGCTCAAATTCAGAATGGCAATCTCGAGATTGCCATTCTGAATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173694.2-1740s1c1
Sequence:CCGGCGGCGACGTATGAGTGTAATTCTCGAGAATTACACTCATACGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173694.2-3348s1c1
Sequence:CCGGCCTGAGATTCTTCTGATAGTACTCGAGTACTATCAGAAGAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173694.2-779s1c1
Sequence:CCGGGCGAATCAATATCTACAGTAACTCGAGTTACTGTAGATATTGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173694.2-2973s1c1
Sequence:CCGGCCCTTCTTATATTGGACATTTCTCGAGAAATGTCCAATATAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173694
ATP11C MISSION shRNA shRNA Plasmid DNA
ATPase, class VI, type 11C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173694.2-5478s1c1
Sequence:CCGGGCTCAAATTCAGAATGGCAATCTCGAGATTGCCATTCTGAATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173694.2-1740s1c1
Sequence:CCGGCGGCGACGTATGAGTGTAATTCTCGAGAATTACACTCATACGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173694.2-3348s1c1
Sequence:CCGGCCTGAGATTCTTCTGATAGTACTCGAGTACTATCAGAAGAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173694.2-779s1c1
Sequence:CCGGGCGAATCAATATCTACAGTAACTCGAGTTACTGTAGATATTGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173694.2-2973s1c1
Sequence:CCGGCCCTTCTTATATTGGACATTTCTCGAGAAATGTCCAATATAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173694
ATP11C MISSION shRNA Lentiviral Transduction Particles
ATPase, class VI, type 11C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173694.2-5478s1c1
Sequence:CCGGGCTCAAATTCAGAATGGCAATCTCGAGATTGCCATTCTGAATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173694.2-1740s1c1
Sequence:CCGGCGGCGACGTATGAGTGTAATTCTCGAGAATTACACTCATACGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173694.2-3348s1c1
Sequence:CCGGCCTGAGATTCTTCTGATAGTACTCGAGTACTATCAGAAGAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173694.2-779s1c1
Sequence:CCGGGCGAATCAATATCTACAGTAACTCGAGTTACTGTAGATATTGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173694.2-2973s1c1
Sequence:CCGGCCCTTCTTATATTGGACATTTCTCGAGAAATGTCCAATATAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks