EMAIL THIS PAGE TO A FRIEND

ATP12A

ATPase, H+/K+ transporting, nongastric, alpha polypeptide

92 Gene Product Result for
Synonyms: ATP1AL1
UniProtKB ID: P54707, Q13816, Q13817, Q16734, Q5W035, Q8N5U2
Gene ID:
Human(479) Summary: The protein encoded by this gene belongs to the family of P-type cation transport ATPases. This gene encodes a catalytic subunit of the ouabain-sensitive H+/K+ -ATPase that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for potassium absorption in various tissues. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Mouse(192113) ATPase, H+/K+ transporting, nongastric, alpha polypeptide
Rat(171028) ATPase, H+/K+ transporting, nongastric, alpha polypeptide
chicken(419743) ATPase, H+/K+ transporting, nongastric, alpha polypeptide
cow(530703) ATPase, H+/K+ transporting, nongastric, alpha polypeptide
Horse(100052912) ATPase, H+/K+ transporting, nongastric, alpha polypeptide
domestic cat(101091583) ATPase, H+/K+ transporting, nongastric, alpha polypeptide
dog(403820) ATPase, H+/K+ transporting, nongastric, alpha polypeptide
sheep(101120253) ATPase, H+/K+ transporting, nongastric, alpha polypeptide
Domestic Rabbit(100008669) ATPase, H+/K+ transporting, nongastric, alpha polypeptide
domestic guinea pig(100135482) ATPase, H+/K+ transporting, nongastric, alpha polypeptide
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138652 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138652 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138652 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001676 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043951 MISSION® esiRNA esiRNA human ATP12A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001676 Rosetta Predictions human pricing
NM_133517 Rosetta Predictions rat pricing
NM_138652 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241811 predicted 222
2 SASI_Hs01_00241812 predicted 1931
3 SASI_Hs02_00332317 predicted 2715
4 SASI_Hs02_00332318 predicted 3286
5 SASI_Hs01_00241814 predicted 1457
6 SASI_Hs02_00332319 predicted 2555
7 SASI_Hs01_00241816 predicted 2279
8 SASI_Hs01_00241819 predicted 3108
9 SASI_Hs02_00332320 predicted 2941
10 SASI_Hs02_00332321 predicted 1417
11 SASI_Hs01_00241813 predicted 1040
12 SASI_Hs01_00241815 predicted 871
13 SASI_Hs01_00241817 predicted 2542
14 SASI_Hs01_00241818 predicted 3321
15 SASI_Hs01_00241820 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133517 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267697 predicted 2539
2 SASI_Rn01_00109340 predicted 3240
3 SASI_Rn01_00109341 predicted 1499
4 SASI_Rn01_00109342 predicted 2484
5 SASI_Rn01_00109343 predicted 1891
6 SASI_Rn01_00109344 predicted 704
7 SASI_Rn01_00109345 predicted 2863
8 SASI_Rn01_00109347 predicted 907
9 SASI_Rn01_00109348 predicted 3127
10 SASI_Rn01_00109349 predicted 2353
11 SASI_Rn01_00109346 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092282 predicted 3352
2 SASI_Mm01_00092283 predicted 1430
3 SASI_Mm01_00092284 predicted 703
4 SASI_Mm01_00092285 predicted 638
5 SASI_Mm01_00092286 predicted 2477
6 SASI_Mm01_00092287 predicted 1607
7 SASI_Mm01_00092288 predicted 2302
8 SASI_Mm01_00092289 predicted 2847
9 SASI_Mm01_00092290 predicted 2885
10 SASI_Mm01_00092291 predicted 2799
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138652
ATP12A MISSION shRNA Bacterial Glycerol Stock
ATPase, H+/K+ transporting, nongastric, alpha polypeptide
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138652.1-3691s1c1
Sequence:CCGGGCCTTAAGCTAGGCTGTGATTCTCGAGAATCACAGCCTAGCTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138652.1-3059s1c1
Sequence:CCGGGCCATCATGGTCCAACAAATTCTCGAGAATTTGTTGGACCATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138652.1-1551s1c1
Sequence:CCGGCCAAGATAATAACACTGTGTACTCGAGTACACAGTGTTATTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138652.1-2884s1c1
Sequence:CCGGCCTCGTCTATTTCACTGTCTACTCGAGTAGACAGTGAAATAGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138652.1-2168s1c1
Sequence:CCGGGCCAAGAGTGTAGGAATCATACTCGAGTATGATTCCTACACTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138652.2-1616s21c1
Sequence:CCGGTAAAGTTCTCAGAGGTTATTTCTCGAGAAATAACCTCTGAGAACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138652.2-2500s21c1
Sequence:CCGGGATGACAACTTTGCATCTATACTCGAGTATAGATGCAAAGTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138652.2-3777s21c1
Sequence:CCGGGTGACTTAAGTGCTAATATTTCTCGAGAAATATTAGCACTTAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138652.2-650s21c1
Sequence:CCGGTACTTGTCCTGGTCGTTATTTCTCGAGAAATAACGACCAGGACAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138652
ATP12A MISSION shRNA shRNA Plasmid DNA
ATPase, H+/K+ transporting, nongastric, alpha polypeptide
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138652.1-3691s1c1
Sequence:CCGGGCCTTAAGCTAGGCTGTGATTCTCGAGAATCACAGCCTAGCTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138652.1-3059s1c1
Sequence:CCGGGCCATCATGGTCCAACAAATTCTCGAGAATTTGTTGGACCATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138652.1-1551s1c1
Sequence:CCGGCCAAGATAATAACACTGTGTACTCGAGTACACAGTGTTATTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138652.1-2884s1c1
Sequence:CCGGCCTCGTCTATTTCACTGTCTACTCGAGTAGACAGTGAAATAGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138652.1-2168s1c1
Sequence:CCGGGCCAAGAGTGTAGGAATCATACTCGAGTATGATTCCTACACTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138652.2-1616s21c1
Sequence:CCGGTAAAGTTCTCAGAGGTTATTTCTCGAGAAATAACCTCTGAGAACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138652.2-2500s21c1
Sequence:CCGGGATGACAACTTTGCATCTATACTCGAGTATAGATGCAAAGTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138652.2-3777s21c1
Sequence:CCGGGTGACTTAAGTGCTAATATTTCTCGAGAAATATTAGCACTTAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138652.2-650s21c1
Sequence:CCGGTACTTGTCCTGGTCGTTATTTCTCGAGAAATAACGACCAGGACAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138652
ATP12A MISSION shRNA Lentiviral Transduction Particles
ATPase, H+/K+ transporting, nongastric, alpha polypeptide
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138652.1-3691s1c1
Sequence:CCGGGCCTTAAGCTAGGCTGTGATTCTCGAGAATCACAGCCTAGCTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138652.1-3059s1c1
Sequence:CCGGGCCATCATGGTCCAACAAATTCTCGAGAATTTGTTGGACCATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138652.1-1551s1c1
Sequence:CCGGCCAAGATAATAACACTGTGTACTCGAGTACACAGTGTTATTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138652.1-2884s1c1
Sequence:CCGGCCTCGTCTATTTCACTGTCTACTCGAGTAGACAGTGAAATAGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138652.1-2168s1c1
Sequence:CCGGGCCAAGAGTGTAGGAATCATACTCGAGTATGATTCCTACACTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138652.2-1616s21c1
Sequence:CCGGTAAAGTTCTCAGAGGTTATTTCTCGAGAAATAACCTCTGAGAACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138652.2-2500s21c1
Sequence:CCGGGATGACAACTTTGCATCTATACTCGAGTATAGATGCAAAGTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138652.2-3777s21c1
Sequence:CCGGGTGACTTAAGTGCTAATATTTCTCGAGAAATATTAGCACTTAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138652.2-650s21c1
Sequence:CCGGTACTTGTCCTGGTCGTTATTTCTCGAGAAATAACGACCAGGACAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001676
ATP12A MISSION shRNA Bacterial Glycerol Stock
ATPase, H+/K+ transporting, nongastric, alpha polypeptide
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001676.2-2840s1c1
Sequence:CCGGCTTGTGTATTTCACCGTCTATCTCGAGATAGACGGTGAAATACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001676.2-2554s1c1
Sequence:CCGGCCTCAAGAAGACTATTGCTTACTCGAGTAAGCAATAGTCTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001676.2-1031s1c1
Sequence:CCGGCGCACCATCATTGGCCATATTCTCGAGAATATGGCCAATGATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001676.2-1496s1c1
Sequence:CCGGGCCTCCTTATCCAAGATAATACTCGAGTATTATCTTGGATAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001676.2-1094s1c1
Sequence:CCGGGCCATTGAGATCGAGCACTTTCTCGAGAAAGTGCTCGATCTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001676.4-2691s21c1
Sequence:CCGGTTGCCTTGGCGTACGAGAAAGCTCGAGCTTTCTCGTACGCCAAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001676.4-2389s21c1
Sequence:CCGGTAATGACTCTCCGGCTCTAAACTCGAGTTTAGAGCCGGAGAGTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001676.4-989s21c1
Sequence:CCGGACTGTCACCGGCATGGTTATCCTCGAGGATAACCATGCCGGTGACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001676
ATP12A MISSION shRNA shRNA Plasmid DNA
ATPase, H+/K+ transporting, nongastric, alpha polypeptide
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001676.2-2840s1c1
Sequence:CCGGCTTGTGTATTTCACCGTCTATCTCGAGATAGACGGTGAAATACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001676.2-2554s1c1
Sequence:CCGGCCTCAAGAAGACTATTGCTTACTCGAGTAAGCAATAGTCTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001676.2-1031s1c1
Sequence:CCGGCGCACCATCATTGGCCATATTCTCGAGAATATGGCCAATGATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001676.2-1496s1c1
Sequence:CCGGGCCTCCTTATCCAAGATAATACTCGAGTATTATCTTGGATAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001676.2-1094s1c1
Sequence:CCGGGCCATTGAGATCGAGCACTTTCTCGAGAAAGTGCTCGATCTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001676.4-2691s21c1
Sequence:CCGGTTGCCTTGGCGTACGAGAAAGCTCGAGCTTTCTCGTACGCCAAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001676.4-2389s21c1
Sequence:CCGGTAATGACTCTCCGGCTCTAAACTCGAGTTTAGAGCCGGAGAGTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001676.4-989s21c1
Sequence:CCGGACTGTCACCGGCATGGTTATCCTCGAGGATAACCATGCCGGTGACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001676
ATP12A MISSION shRNA Lentiviral Transduction Particles
ATPase, H+/K+ transporting, nongastric, alpha polypeptide
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001676.2-2840s1c1
Sequence:CCGGCTTGTGTATTTCACCGTCTATCTCGAGATAGACGGTGAAATACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001676.2-2554s1c1
Sequence:CCGGCCTCAAGAAGACTATTGCTTACTCGAGTAAGCAATAGTCTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001676.2-1031s1c1
Sequence:CCGGCGCACCATCATTGGCCATATTCTCGAGAATATGGCCAATGATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001676.2-1496s1c1
Sequence:CCGGGCCTCCTTATCCAAGATAATACTCGAGTATTATCTTGGATAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001676.2-1094s1c1
Sequence:CCGGGCCATTGAGATCGAGCACTTTCTCGAGAAAGTGCTCGATCTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001676.4-2691s21c1
Sequence:CCGGTTGCCTTGGCGTACGAGAAAGCTCGAGCTTTCTCGTACGCCAAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001676.4-2389s21c1
Sequence:CCGGTAATGACTCTCCGGCTCTAAACTCGAGTTTAGAGCCGGAGAGTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001676.4-989s21c1
Sequence:CCGGACTGTCACCGGCATGGTTATCCTCGAGGATAACCATGCCGGTGACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks