EMAIL THIS PAGE TO A FRIEND

ATP13A2

ATPase type 13A2

65 Gene Product Result for
Synonyms: CLN12 HSA9947 KRPPD PARK9
UniProtKB ID: Q9NQ11, O75700, Q5JXY1, Q5JXY2, Q6S9Z9
Gene ID:
Human(23400) Summary: This gene encodes a member of the P5 subfamily of ATPases which transports inorganic cations as well as other substrates. Mutations in this gene are associated with Kufor-Rakeb syndrome (KRS), also referred to as Parkinson disease 9. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2008]
Mouse(74772) ATPase type 13A2
Rat(362645) ATPase type 13A2
sheep(101108996) ATPase type 13A2
naked mole-rat(101724673) ATPase type 13A2
Zebrafish(568666) ATPase type 13A2
dog(100686975) ATPase type 13A2
Horse(100053155) ATPase type 13A2
cow(510792) ATPase type 13A2
domestic cat(101086491) ATPase type 13A2
chicken(419466) ATPase type 13A2
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029097 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029097 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029097 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022089 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022089 Rosetta Predictions human pricing
XM_001072145 Rosetta Predictions rat pricing
XM_342962 Rosetta Predictions rat pricing
NM_029097 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012834 predicted 2814
2 SASI_Hs01_00012835 predicted 878
3 SASI_Hs01_00012836 predicted 3141
4 SASI_Hs01_00012837 predicted 689
5 SASI_Hs02_00355471 predicted 319
6 SASI_Hs01_00012838 predicted 545
7 SASI_Hs01_00012839 predicted 2690
8 SASI_Hs02_00355472 predicted 2519
9 SASI_Hs01_00012840 predicted 1273
10 SASI_Hs01_00012842 predicted 2231
11 SASI_Hs01_00012841 predicted 303
12 SASI_Hs01_00012843 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337968 predicted 1446
2 SASI_Rn02_00337969 predicted 3472
3 SASI_Rn02_00337970 predicted 729
4 SASI_Rn02_00337971 predicted 3508
5 SASI_Rn02_00337972 predicted 3173
6 SASI_Rn02_00337973 predicted 2138
7 SASI_Rn02_00337974 predicted 2126
8 SASI_Rn02_00337975 predicted 3193
9 SASI_Rn02_00337976 predicted 1056
10 SASI_Rn02_00337977 predicted 3214
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395133 predicted 1437
2 SASI_Rn02_00395134 predicted 3470
3 SASI_Rn02_00395135 predicted 736
4 SASI_Rn02_00395136 predicted 3516
5 SASI_Rn02_00395137 predicted 3177
6 SASI_Rn02_00395138 predicted 2135
7 SASI_Rn02_00395139 predicted 2120
8 SASI_Rn02_00395140 predicted 3199
9 SASI_Rn02_00395141 predicted 1059
10 SASI_Rn02_00395142 predicted 3218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029097 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105992 predicted 1854
2 SASI_Mm01_00105993 predicted 598
3 SASI_Mm01_00105994 predicted 3183
4 SASI_Mm01_00105995 predicted 2769
5 SASI_Mm01_00105996 predicted 2885
6 SASI_Mm01_00105997 predicted 1838
7 SASI_Mm01_00105998 predicted 2111
8 SASI_Mm01_00105999 predicted 784
9 SASI_Mm01_00106000 predicted 2842
10 SASI_Mm01_00106001 predicted 1867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029097
ATP13A2 MISSION shRNA Bacterial Glycerol Stock
ATPase type 13A2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029097.1-3707s1c1
Sequence:CCGGGAACTCTCTCAAGAGACAGTACTCGAGTACTGTCTCTTGAGAGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029097.1-881s1c1
Sequence:CCGGGCCGACCACTACTACTGGTATCTCGAGATACCAGTAGTAGTGGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029097.1-389s1c1
Sequence:CCGGCACGCCGAAACACTCGTTATACTCGAGTATAACGAGTGTTTCGGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029097.1-2950s1c1
Sequence:CCGGGCTCATTCTCTACACAATCAACTCGAGTTGATTGTGTAGAGAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029097.1-392s1c1
Sequence:CCGGGCCGAAACACTCGTTATAGAACTCGAGTTCTATAACGAGTGTTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029097
ATP13A2 MISSION shRNA shRNA Plasmid DNA
ATPase type 13A2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029097.1-3707s1c1
Sequence:CCGGGAACTCTCTCAAGAGACAGTACTCGAGTACTGTCTCTTGAGAGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029097.1-881s1c1
Sequence:CCGGGCCGACCACTACTACTGGTATCTCGAGATACCAGTAGTAGTGGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029097.1-389s1c1
Sequence:CCGGCACGCCGAAACACTCGTTATACTCGAGTATAACGAGTGTTTCGGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029097.1-2950s1c1
Sequence:CCGGGCTCATTCTCTACACAATCAACTCGAGTTGATTGTGTAGAGAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029097.1-392s1c1
Sequence:CCGGGCCGAAACACTCGTTATAGAACTCGAGTTCTATAACGAGTGTTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029097
ATP13A2 MISSION shRNA Lentiviral Transduction Particles
ATPase type 13A2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029097.1-3707s1c1
Sequence:CCGGGAACTCTCTCAAGAGACAGTACTCGAGTACTGTCTCTTGAGAGAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029097.1-881s1c1
Sequence:CCGGGCCGACCACTACTACTGGTATCTCGAGATACCAGTAGTAGTGGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029097.1-389s1c1
Sequence:CCGGCACGCCGAAACACTCGTTATACTCGAGTATAACGAGTGTTTCGGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029097.1-2950s1c1
Sequence:CCGGGCTCATTCTCTACACAATCAACTCGAGTTGATTGTGTAGAGAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029097.1-392s1c1
Sequence:CCGGGCCGAAACACTCGTTATAGAACTCGAGTTCTATAACGAGTGTTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022089
ATP13A2 MISSION shRNA Bacterial Glycerol Stock
ATPase type 13A2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022089.1-1279s1c1
Sequence:CCGGGCCCATCAACTTCAAGTTCTACTCGAGTAGAACTTGAAGTTGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022089.1-88s1c1
Sequence:CCGGCCTGACGATAGGGACATCAATCTCGAGATTGATGTCCCTATCGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022089.1-2878s1c1
Sequence:CCGGCCTGATCCTCTACACGATCAACTCGAGTTGATCGTGTAGAGGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022089.1-1390s1c1
Sequence:CCGGGCCTCTGAATGAGATTGTAATCTCGAGATTACAATCTCATTCAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022089.1-298s1c1
Sequence:CCGGCGTTATCGAAATAAGAGACAACTCGAGTTGTCTCTTATTTCGATAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022089.2-1010s21c1
Sequence:CCGGTCGCTGTACAAGACCAGAAAGCTCGAGCTTTCTGGTCTTGTACAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022089.2-2670s21c1
Sequence:CCGGGGCCCACCTTTGGTATCATTGCTCGAGCAATGATACCAAAGGTGGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022089.2-1043s21c1
Sequence:CCGGCTAAGGGACATGGTCAAGTTGCTCGAGCAACTTGACCATGTCCCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022089
ATP13A2 MISSION shRNA shRNA Plasmid DNA
ATPase type 13A2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022089.1-1279s1c1
Sequence:CCGGGCCCATCAACTTCAAGTTCTACTCGAGTAGAACTTGAAGTTGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022089.1-88s1c1
Sequence:CCGGCCTGACGATAGGGACATCAATCTCGAGATTGATGTCCCTATCGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022089.1-2878s1c1
Sequence:CCGGCCTGATCCTCTACACGATCAACTCGAGTTGATCGTGTAGAGGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022089.1-1390s1c1
Sequence:CCGGGCCTCTGAATGAGATTGTAATCTCGAGATTACAATCTCATTCAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022089.1-298s1c1
Sequence:CCGGCGTTATCGAAATAAGAGACAACTCGAGTTGTCTCTTATTTCGATAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022089.2-1010s21c1
Sequence:CCGGTCGCTGTACAAGACCAGAAAGCTCGAGCTTTCTGGTCTTGTACAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022089.2-2670s21c1
Sequence:CCGGGGCCCACCTTTGGTATCATTGCTCGAGCAATGATACCAAAGGTGGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022089.2-1043s21c1
Sequence:CCGGCTAAGGGACATGGTCAAGTTGCTCGAGCAACTTGACCATGTCCCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022089
ATP13A2 MISSION shRNA Lentiviral Transduction Particles
ATPase type 13A2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022089.1-1279s1c1
Sequence:CCGGGCCCATCAACTTCAAGTTCTACTCGAGTAGAACTTGAAGTTGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022089.1-88s1c1
Sequence:CCGGCCTGACGATAGGGACATCAATCTCGAGATTGATGTCCCTATCGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022089.1-2878s1c1
Sequence:CCGGCCTGATCCTCTACACGATCAACTCGAGTTGATCGTGTAGAGGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022089.1-1390s1c1
Sequence:CCGGGCCTCTGAATGAGATTGTAATCTCGAGATTACAATCTCATTCAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022089.1-298s1c1
Sequence:CCGGCGTTATCGAAATAAGAGACAACTCGAGTTGTCTCTTATTTCGATAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022089.2-1010s21c1
Sequence:CCGGTCGCTGTACAAGACCAGAAAGCTCGAGCTTTCTGGTCTTGTACAGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022089.2-2670s21c1
Sequence:CCGGGGCCCACCTTTGGTATCATTGCTCGAGCAATGATACCAAAGGTGGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022089.2-1043s21c1
Sequence:CCGGCTAAGGGACATGGTCAAGTTGCTCGAGCAACTTGACCATGTCCCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)