EMAIL THIS PAGE TO A FRIEND

ATP13A3

ATPase type 13A3

Synonyms: AFURS1
UniProtKB ID: Q9H7F0, Q8NC11, Q96KS1
Gene ID:
Human(79572) Summary: ATP13A3 is a member of the P-type ATPase family of proteins that transport a variety of cations across membranes. Other P-type ATPases include ATP7B (MIM 606882) and ATP7A (MIM 300011).[supplied by OMIM, Aug 2008]
Mouse(224088) ATPase type 13A3
Rat(678704) ATPase type 13A3
chicken(424898) ATPase type 13A3
cow(523889) ATPase type 13A3
Horse(100069072) ATPase type 13A3
domestic cat(101090204) ATPase type 13A3
dog(478607) ATPase type 13A3
naked mole-rat(101726426) ATPase type 13A3
sheep(101106047) ATPase type 13A3
Gene Class: ATPase
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001128094 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001128094 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001128094 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024524 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024524 Rosetta Predictions human pricing
XM_927225 Rosetta Predictions human pricing
XM_931948 Rosetta Predictions human pricing
NM_001109369 Rosetta Predictions rat pricing
NM_001128094 Rosetta Predictions mouse pricing
NM_001128096 Rosetta Predictions mouse pricing
XM_901167 Rosetta Predictions mouse pricing
XM_994902 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356805 predicted 2386
2 SASI_Hs02_00356806 predicted 2448
3 SASI_Hs02_00356807 predicted 1492
4 SASI_Hs02_00356808 predicted 1117
5 SASI_Hs02_00356809 predicted 731
6 SASI_Hs02_00356810 predicted 2239
7 SASI_Hs02_00356811 predicted 3030
8 SASI_Hs02_00356812 predicted 4082
9 SASI_Hs02_00356813 predicted 918
10 SASI_Hs02_00356814 predicted 2437
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290837 predicted 534
2 SASI_Hs01_00290838 predicted 1248
3 SASI_Hs01_00290839 predicted 1305
4 SASI_Hs01_00290840 predicted 346
5 SASI_Hs01_00290841 predicted 1570
6 SASI_Hs01_00290842 predicted 1654
7 SASI_Hs01_00290843 predicted 1095
8 SASI_Hs01_00290844 predicted 1888
9 SASI_Hs01_00290845 predicted 2933
10 SASI_Hs01_00290846 predicted 1685
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277529 predicted 2197
2 SASI_Hs01_00277530 predicted 2919
3 SASI_Hs01_00277531 predicted 2974
4 SASI_Hs01_00277532 predicted 2062
5 SASI_Hs01_00277533 predicted 2014
6 SASI_Hs01_00277534 predicted 3233
7 SASI_Hs01_00277535 predicted 2618
8 SASI_Hs01_00277536 predicted 3324
9 SASI_Hs01_00277537 predicted 2763
10 SASI_Hs01_00277538 predicted 3557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247754 predicted 235
2 SASI_Rn02_00247755 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310508 predicted 1016
2 SASI_Mm02_00310509 predicted 2693
3 SASI_Mm02_00310510 predicted 2310
4 SASI_Mm02_00310511 predicted 2251
5 SASI_Mm02_00310512 predicted 1399
6 SASI_Mm02_00310513 predicted 978
7 SASI_Mm02_00310514 predicted 1008
8 SASI_Mm02_00310515 predicted 1350
9 SASI_Mm02_00310516 predicted 665
10 SASI_Mm02_00310517 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310518 predicted 1017
2 SASI_Mm02_00310519 predicted 2690
3 SASI_Mm02_00310520 predicted 2317
4 SASI_Mm02_00310521 predicted 2251
5 SASI_Mm02_00310522 predicted 1399
6 SASI_Mm02_00310523 predicted 978
7 SASI_Mm02_00310524 predicted 1007
8 SASI_Mm02_00310525 predicted 1356
9 SASI_Mm02_00310526 predicted 667
10 SASI_Mm02_00310527 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224283 predicted 289
2 SASI_Mm01_00224284 predicted 295
3 SASI_Mm01_00224285 predicted 462
4 SASI_Mm01_00224286 predicted 515
5 SASI_Mm01_00224287 predicted 401
6 SASI_Mm01_00224288 predicted 258
7 SASI_Mm01_00224289 predicted 521
8 SASI_Mm01_00224290 predicted 286
9 SASI_Mm01_00224291 predicted 456
10 SASI_Mm01_00224292 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00240288 predicted 1020
2 SASI_Mm01_00240289 predicted 2703
3 SASI_Mm01_00240290 predicted 2117
4 SASI_Mm01_00240291 predicted 2254
5 SASI_Mm01_00240292 predicted 1403
6 SASI_Mm01_00240293 predicted 2305
7 SASI_Mm01_00240294 predicted 1018
8 SASI_Mm01_00240295 predicted 3676
9 SASI_Mm01_00240296 predicted 1359
10 SASI_Mm01_00240297 predicted 3402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128094
VALIDATED
ATP13A3 MISSION shRNA Bacterial Glycerol Stock
ATPase type 13A3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128094.1-3673s21c1
Sequence:CCGGCCATACCAGTGGCGCATATATCTCGAGATATATGCGCCACTGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128094.1-988s21c1
Sequence:CCGGATGTCCGTAGTATCCATTATACTCGAGTATAATGGATACTACGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128094.1-945s21c1
Sequence:CCGGGAGCGTTGATGAGTACTATTACTCGAGTAATAGTACTCATCAACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128094.1-666s21c1
Sequence:CCGGGTCACAACAGATGCGTTATTTCTCGAGAAATAACGCATCTGTTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128094.1-4437s21c1
Sequence:CCGGATAGAGCAACTCAGGTAATTTCTCGAGAAATTACCTGAGTTGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128094
VALIDATED
ATP13A3 MISSION shRNA shRNA Plasmid DNA
ATPase type 13A3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128094.1-3673s21c1
Sequence:CCGGCCATACCAGTGGCGCATATATCTCGAGATATATGCGCCACTGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128094.1-988s21c1
Sequence:CCGGATGTCCGTAGTATCCATTATACTCGAGTATAATGGATACTACGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128094.1-945s21c1
Sequence:CCGGGAGCGTTGATGAGTACTATTACTCGAGTAATAGTACTCATCAACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128094.1-666s21c1
Sequence:CCGGGTCACAACAGATGCGTTATTTCTCGAGAAATAACGCATCTGTTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128094.1-4437s21c1
Sequence:CCGGATAGAGCAACTCAGGTAATTTCTCGAGAAATTACCTGAGTTGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128094
VALIDATED
ATP13A3 MISSION shRNA Lentiviral Transduction Particles
ATPase type 13A3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128094.1-3673s21c1
Sequence:CCGGCCATACCAGTGGCGCATATATCTCGAGATATATGCGCCACTGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128094.1-988s21c1
Sequence:CCGGATGTCCGTAGTATCCATTATACTCGAGTATAATGGATACTACGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128094.1-945s21c1
Sequence:CCGGGAGCGTTGATGAGTACTATTACTCGAGTAATAGTACTCATCAACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128094.1-666s21c1
Sequence:CCGGGTCACAACAGATGCGTTATTTCTCGAGAAATAACGCATCTGTTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128094.1-4437s21c1
Sequence:CCGGATAGAGCAACTCAGGTAATTTCTCGAGAAATTACCTGAGTTGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024524
VALIDATED
ATP13A3 MISSION shRNA Bacterial Glycerol Stock
ATPase type 13A3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000242971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024524.3-5205s21c1
Sequence:CCGGTCGTTACAAATGAGCATATTTCTCGAGAAATATGCTCATTTGTAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_024524.3-801s21c1
Sequence:CCGGATCACAACAGATTCGTTATTTCTCGAGAAATAACGAATCTGTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024524.3-1136s21c1
Sequence:CCGGCAATCGTAAGCTCACTATATTCTCGAGAATATAGTGAGCTTACGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024524.3-3389s21c1
Sequence:CCGGGACCACCTTCGGGTCTTATATCTCGAGATATAAGACCCGAAGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024524
VALIDATED
ATP13A3 MISSION shRNA shRNA Plasmid DNA
ATPase type 13A3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000242971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024524.3-5205s21c1
Sequence:CCGGTCGTTACAAATGAGCATATTTCTCGAGAAATATGCTCATTTGTAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_024524.3-801s21c1
Sequence:CCGGATCACAACAGATTCGTTATTTCTCGAGAAATAACGAATCTGTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024524.3-1136s21c1
Sequence:CCGGCAATCGTAAGCTCACTATATTCTCGAGAATATAGTGAGCTTACGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024524.3-3389s21c1
Sequence:CCGGGACCACCTTCGGGTCTTATATCTCGAGATATAAGACCCGAAGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024524
VALIDATED
ATP13A3 MISSION shRNA Lentiviral Transduction Particles
ATPase type 13A3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000242971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024524.3-5205s21c1
Sequence:CCGGTCGTTACAAATGAGCATATTTCTCGAGAAATATGCTCATTTGTAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_024524.3-801s21c1
Sequence:CCGGATCACAACAGATTCGTTATTTCTCGAGAAATAACGAATCTGTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024524.3-1136s21c1
Sequence:CCGGCAATCGTAAGCTCACTATATTCTCGAGAATATAGTGAGCTTACGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024524.3-3389s21c1
Sequence:CCGGGACCACCTTCGGGTCTTATATCTCGAGATATAAGACCCGAAGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks