EMAIL THIS PAGE TO A FRIEND

ATP13A4

ATPase type 13A4

76 Gene Product Result for
UniProtKB ID: Q4VNC1, B7WPC7, Q6UY23, Q8N1Q9, Q9H043
Gene ID:
Mouse(224079) ATPase type 13A4
Rat(288026) ATPase type 13A4
sheep(101107059) ATPase type 13A4
naked mole-rat(101700201) ATPase type 13A4
chicken(424901) ATPase type 13A4
cow(521728) ATPase type 13A4
Horse(100068981) ATPase type 13A4
domestic cat(101091472) ATPase type 13A4
dog(612791) ATPase type 13A4
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032279 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172613 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172613 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172613 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065271 MISSION® esiRNA esiRNA human ATP13A4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032279 Rosetta Predictions human pricing
XM_001053714 Rosetta Predictions rat pricing
XM_221355 Rosetta Predictions rat pricing
NM_172613 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137261 predicted 651
2 SASI_Hs02_00359598 predicted 2410
3 SASI_Hs01_00137263 predicted 2360
4 SASI_Hs01_00137264 predicted 994
5 SASI_Hs01_00137265 predicted 760
6 SASI_Hs01_00137266 predicted 3285
7 SASI_Hs01_00137267 predicted 377
8 SASI_Hs02_00359599 predicted 1044
9 SASI_Hs01_00137268 predicted 678
10 SASI_Hs01_00137270 predicted 481
11 SASI_Hs01_00137262 predicted 3143
12 SASI_Hs01_00137269 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053714 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273310 predicted 3412
2 SASI_Rn02_00273311 predicted 3554
3 SASI_Rn02_00273312 predicted 287
4 SASI_Rn02_00273313 predicted 3820
5 SASI_Rn02_00273314 predicted 755
6 SASI_Rn02_00273315 predicted 775
7 SASI_Rn02_00273316 predicted 2804
8 SASI_Rn02_00273317 predicted 3217
9 SASI_Rn02_00273318 predicted 3266
10 SASI_Rn02_00273319 predicted 3635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221355 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380037 predicted 3016
2 SASI_Rn02_00380038 predicted 555
3 SASI_Rn02_00380039 predicted 607
4 SASI_Rn02_00380040 predicted 284
5 SASI_Rn02_00380041 predicted 1010
6 SASI_Rn02_00380042 predicted 2445
7 SASI_Rn02_00380043 predicted 750
8 SASI_Rn02_00380044 predicted 775
9 SASI_Rn02_00380045 predicted 2804
10 SASI_Rn02_00380046 predicted 2671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124682 predicted 3761
2 SASI_Mm02_00344319 predicted 546
3 SASI_Mm01_00124683 predicted 585
4 SASI_Mm01_00124684 predicted 716
5 SASI_Mm01_00124685 predicted 3303
6 SASI_Mm01_00124686 predicted 698
7 SASI_Mm01_00124688 predicted 3740
8 SASI_Mm01_00124689 predicted 2840
9 SASI_Mm01_00124690 predicted 753
10 SASI_Mm01_00124691 predicted 3693
11 SASI_Mm01_00124687 predicted 2257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032279
ATP13A4 MISSION shRNA Bacterial Glycerol Stock
ATPase type 13A4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000220058    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032279.2-3897s1c1
Sequence:CCGGCTTGGCTTCTGAAGGTATTAGCTCGAGCTAATACCTTCAGAAGCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220059    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032279.2-4065s1c1
Sequence:CCGGGTATACTCACGGAGTTGTAATCTCGAGATTACAACTCCGTGAGTATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-1261s1c1
Sequence:CCGGCTCTACCCTAAGCCAGTGAATCTCGAGATTCACTGGCTTAGGGTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-829s1c1
Sequence:CCGGGTATATGATCTCAGAGAGCAACTCGAGTTGCTCTCTGAGATCATATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-2360s1c1
Sequence:CCGGCCTCATCAGCATCTATATCTTCTCGAGAAGATATAGATGCTGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-642s1c1
Sequence:CCGGGAGGTTAATATGTGGGCCTAACTCGAGTTAGGCCCACATATTAACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-1408s1c1
Sequence:CCGGGCCCTTGACGTCATCACAATTCTCGAGAATTGTGATGACGTCAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-217s1c1
Sequence:CCGGGCCGGATCCATCTTCTCATTTCTCGAGAAATGAGAAGATGGATCCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-699s1c1
Sequence:CCGGGCTCATCAAGGAGGTTCTAAACTCGAGTTTAGAACCTCCTTGATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-2531s1c1
Sequence:CCGGGCAGCCTACTGCCAAAGATATCTCGAGATATCTTTGGCAGTAGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032279
ATP13A4 MISSION shRNA shRNA Plasmid DNA
ATPase type 13A4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000220058    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032279.2-3897s1c1
Sequence:CCGGCTTGGCTTCTGAAGGTATTAGCTCGAGCTAATACCTTCAGAAGCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220059    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032279.2-4065s1c1
Sequence:CCGGGTATACTCACGGAGTTGTAATCTCGAGATTACAACTCCGTGAGTATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-1261s1c1
Sequence:CCGGCTCTACCCTAAGCCAGTGAATCTCGAGATTCACTGGCTTAGGGTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-829s1c1
Sequence:CCGGGTATATGATCTCAGAGAGCAACTCGAGTTGCTCTCTGAGATCATATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-2360s1c1
Sequence:CCGGCCTCATCAGCATCTATATCTTCTCGAGAAGATATAGATGCTGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-642s1c1
Sequence:CCGGGAGGTTAATATGTGGGCCTAACTCGAGTTAGGCCCACATATTAACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-1408s1c1
Sequence:CCGGGCCCTTGACGTCATCACAATTCTCGAGAATTGTGATGACGTCAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-217s1c1
Sequence:CCGGGCCGGATCCATCTTCTCATTTCTCGAGAAATGAGAAGATGGATCCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-699s1c1
Sequence:CCGGGCTCATCAAGGAGGTTCTAAACTCGAGTTTAGAACCTCCTTGATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-2531s1c1
Sequence:CCGGGCAGCCTACTGCCAAAGATATCTCGAGATATCTTTGGCAGTAGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032279
ATP13A4 MISSION shRNA Lentiviral Transduction Particles
ATPase type 13A4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000220058    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032279.2-3897s1c1
Sequence:CCGGCTTGGCTTCTGAAGGTATTAGCTCGAGCTAATACCTTCAGAAGCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220059    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032279.2-4065s1c1
Sequence:CCGGGTATACTCACGGAGTTGTAATCTCGAGATTACAACTCCGTGAGTATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-1261s1c1
Sequence:CCGGCTCTACCCTAAGCCAGTGAATCTCGAGATTCACTGGCTTAGGGTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-829s1c1
Sequence:CCGGGTATATGATCTCAGAGAGCAACTCGAGTTGCTCTCTGAGATCATATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-2360s1c1
Sequence:CCGGCCTCATCAGCATCTATATCTTCTCGAGAAGATATAGATGCTGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-642s1c1
Sequence:CCGGGAGGTTAATATGTGGGCCTAACTCGAGTTAGGCCCACATATTAACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-1408s1c1
Sequence:CCGGGCCCTTGACGTCATCACAATTCTCGAGAATTGTGATGACGTCAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-217s1c1
Sequence:CCGGGCCGGATCCATCTTCTCATTTCTCGAGAAATGAGAAGATGGATCCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-699s1c1
Sequence:CCGGGCTCATCAAGGAGGTTCTAAACTCGAGTTTAGAACCTCCTTGATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032279.1-2531s1c1
Sequence:CCGGGCAGCCTACTGCCAAAGATATCTCGAGATATCTTTGGCAGTAGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172613
ATP13A4 MISSION shRNA Bacterial Glycerol Stock
ATPase type 13A4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172613.2-3710s1c1
Sequence:CCGGCGATACCTAAACAGTTATCAACTCGAGTTGATAACTGTTTAGGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172613.2-2534s1c1
Sequence:CCGGGCCAATATTTCAGCAGCTTATCTCGAGATAAGCTGCTGAAATATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172613.2-2381s1c1
Sequence:CCGGCGGCATCTATCTCTTGGAAATCTCGAGATTTCCAAGAGATAGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172613.2-1344s1c1
Sequence:CCGGGCCCATGAACTTCAAGCTCTACTCGAGTAGAGCTTGAAGTTCATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172613.2-2945s1c1
Sequence:CCGGCGACTCTTATTGGTGTAACAACTCGAGTTGTTACACCAATAAGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172613
ATP13A4 MISSION shRNA shRNA Plasmid DNA
ATPase type 13A4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172613.2-3710s1c1
Sequence:CCGGCGATACCTAAACAGTTATCAACTCGAGTTGATAACTGTTTAGGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172613.2-2534s1c1
Sequence:CCGGGCCAATATTTCAGCAGCTTATCTCGAGATAAGCTGCTGAAATATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172613.2-2381s1c1
Sequence:CCGGCGGCATCTATCTCTTGGAAATCTCGAGATTTCCAAGAGATAGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172613.2-1344s1c1
Sequence:CCGGGCCCATGAACTTCAAGCTCTACTCGAGTAGAGCTTGAAGTTCATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172613.2-2945s1c1
Sequence:CCGGCGACTCTTATTGGTGTAACAACTCGAGTTGTTACACCAATAAGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172613
ATP13A4 MISSION shRNA Lentiviral Transduction Particles
ATPase type 13A4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172613.2-3710s1c1
Sequence:CCGGCGATACCTAAACAGTTATCAACTCGAGTTGATAACTGTTTAGGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172613.2-2534s1c1
Sequence:CCGGGCCAATATTTCAGCAGCTTATCTCGAGATAAGCTGCTGAAATATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172613.2-2381s1c1
Sequence:CCGGCGGCATCTATCTCTTGGAAATCTCGAGATTTCCAAGAGATAGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172613.2-1344s1c1
Sequence:CCGGGCCCATGAACTTCAAGCTCTACTCGAGTAGAGCTTGAAGTTCATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172613.2-2945s1c1
Sequence:CCGGCGACTCTTATTGGTGTAACAACTCGAGTTGTTACACCAATAAGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)