EMAIL THIS PAGE TO A FRIEND

ATP13A5

ATPase type 13A5

72 Gene Product Result for
UniProtKB ID: Q4VNC0, Q6UWS4, Q6ZWL0
Gene ID:
Mouse(268878) ATPase type 13A5
Rat(303856) ATPase type 13A5
chicken(424902) ATPase type 13A5
dog(488128) ATPase type 13A5
Horse(100068956) ATPase type 13A5
cow(509596) ATPase type 13A5
domestic cat(101091724) ATPase type 13A5
naked mole-rat(101699850) ATPase type 13A5
sheep(101107321) ATPase type 13A5
Domestic Rabbit(100343989) ATPase type 13A5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175650 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175650 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175650 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198505 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198505 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198505 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198505 Rosetta Predictions human pricing
XM_001053941 Rosetta Predictions rat pricing
XM_001054000 Rosetta Predictions rat pricing
XM_221354 Rosetta Predictions rat pricing
NM_175650 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045908 predicted 2141
2 SASI_Hs01_00045909 predicted 1003
3 SASI_Hs01_00045910 predicted 744
4 SASI_Hs01_00045911 predicted 2997
5 SASI_Hs01_00045912 predicted 3319
6 SASI_Hs01_00045913 predicted 1938
7 SASI_Hs01_00045914 predicted 2741
8 SASI_Hs01_00045915 predicted 3208
9 SASI_Hs01_00045916 predicted 1697
10 SASI_Hs02_00372075 predicted 714
11 SASI_Hs01_00045917 predicted 2911
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053941 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274110 predicted 448
2 SASI_Rn02_00274111 predicted 864
3 SASI_Rn02_00274112 predicted 2454
4 SASI_Rn02_00274113 predicted 2517
5 SASI_Rn02_00274114 predicted 2894
6 SASI_Rn02_00274115 predicted 656
7 SASI_Rn02_00274116 predicted 2003
8 SASI_Rn02_00274117 predicted 313
9 SASI_Rn02_00274118 predicted 3584
10 SASI_Rn02_00274119 predicted 3327
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274302 predicted 516
2 SASI_Rn02_00274303 predicted 922
3 SASI_Rn02_00274304 predicted 2501
4 SASI_Rn02_00274305 predicted 2578
5 SASI_Rn02_00274306 predicted 2951
6 SASI_Rn02_00274307 predicted 720
7 SASI_Rn02_00274308 predicted 2061
8 SASI_Rn02_00274309 predicted 375
9 SASI_Rn02_00274310 predicted 3634
10 SASI_Rn02_00274311 predicted 3382
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380027 predicted 1263
2 SASI_Rn02_00380028 predicted 509
3 SASI_Rn02_00380029 predicted 878
4 SASI_Rn02_00380030 predicted 896
5 SASI_Rn02_00380031 predicted 923
6 SASI_Rn02_00380032 predicted 1135
7 SASI_Rn02_00380033 predicted 1236
8 SASI_Rn02_00380034 predicted 714
9 SASI_Rn02_00380035 predicted 653
10 SASI_Rn02_00380036 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020932 predicted 2518
2 SASI_Mm02_00346593 predicted 2628
3 SASI_Mm02_00346594 predicted 3203
4 SASI_Mm01_00020933 predicted 3645
5 SASI_Mm01_00020934 predicted 2068
6 SASI_Mm02_00346595 predicted 1607
7 SASI_Mm01_00020935 predicted 1868
8 SASI_Mm01_00020938 predicted 769
9 SASI_Mm01_00020939 predicted 891
10 SASI_Mm02_00346596 predicted 2566
11 SASI_Mm01_00020936 predicted 1283
12 SASI_Mm01_00020937 predicted 3721
13 SASI_Mm01_00020940 predicted 3399
14 SASI_Mm01_00020941 predicted 2193
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175650
ATP13A5 MISSION shRNA Bacterial Glycerol Stock
ATPase type 13A5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175650.2-4063s1c1
Sequence:CCGGCCGTATTCATACTGTGTTGTTCTCGAGAACAACACAGTATGAATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175650.2-432s1c1
Sequence:CCGGCCGATGAATTTCGAAGATATACTCGAGTATATCTTCGAAATTCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175650.2-475s1c1
Sequence:CCGGCCACTTATCCACACTGAAGTTCTCGAGAACTTCAGTGTGGATAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175650.2-2914s1c1
Sequence:CCGGCCTGACTATGTACGGCATCATCTCGAGATGATGCCGTACATAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175650.2-2626s1c1
Sequence:CCGGGCTGCCACAAATTCTGGTTAACTCGAGTTAACCAGAATTTGTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175650
ATP13A5 MISSION shRNA shRNA Plasmid DNA
ATPase type 13A5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175650.2-4063s1c1
Sequence:CCGGCCGTATTCATACTGTGTTGTTCTCGAGAACAACACAGTATGAATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175650.2-432s1c1
Sequence:CCGGCCGATGAATTTCGAAGATATACTCGAGTATATCTTCGAAATTCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175650.2-475s1c1
Sequence:CCGGCCACTTATCCACACTGAAGTTCTCGAGAACTTCAGTGTGGATAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175650.2-2914s1c1
Sequence:CCGGCCTGACTATGTACGGCATCATCTCGAGATGATGCCGTACATAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175650.2-2626s1c1
Sequence:CCGGGCTGCCACAAATTCTGGTTAACTCGAGTTAACCAGAATTTGTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175650
ATP13A5 MISSION shRNA Lentiviral Transduction Particles
ATPase type 13A5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175650.2-4063s1c1
Sequence:CCGGCCGTATTCATACTGTGTTGTTCTCGAGAACAACACAGTATGAATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175650.2-432s1c1
Sequence:CCGGCCGATGAATTTCGAAGATATACTCGAGTATATCTTCGAAATTCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175650.2-475s1c1
Sequence:CCGGCCACTTATCCACACTGAAGTTCTCGAGAACTTCAGTGTGGATAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175650.2-2914s1c1
Sequence:CCGGCCTGACTATGTACGGCATCATCTCGAGATGATGCCGTACATAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175650.2-2626s1c1
Sequence:CCGGGCTGCCACAAATTCTGGTTAACTCGAGTTAACCAGAATTTGTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198505
ATP13A5 MISSION shRNA Bacterial Glycerol Stock
ATPase type 13A5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198505.2-1918s1c1
Sequence:CCGGCCCAAGAATTTCCCACAGGAACTCGAGTTCCTGTGGGAAATTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198505.2-3326s1c1
Sequence:CCGGCCATAACATCGTGGAGGGTTTCTCGAGAAACCCTCCACGATGTTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198505.2-1435s1c1
Sequence:CCGGCAAATAAACCTCGTGTGCTTTCTCGAGAAAGCACACGAGGTTTATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198505.2-2161s1c1
Sequence:CCGGGATAACCTTCAAACGGCCATTCTCGAGAATGGCCGTTTGAAGGTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198505.2-2008s1c1
Sequence:CCGGCTTTCAGAAGTCGAGCACTTACTCGAGTAAGTGCTCGACTTCTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198505
ATP13A5 MISSION shRNA shRNA Plasmid DNA
ATPase type 13A5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198505.2-1918s1c1
Sequence:CCGGCCCAAGAATTTCCCACAGGAACTCGAGTTCCTGTGGGAAATTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198505.2-3326s1c1
Sequence:CCGGCCATAACATCGTGGAGGGTTTCTCGAGAAACCCTCCACGATGTTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198505.2-1435s1c1
Sequence:CCGGCAAATAAACCTCGTGTGCTTTCTCGAGAAAGCACACGAGGTTTATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198505.2-2161s1c1
Sequence:CCGGGATAACCTTCAAACGGCCATTCTCGAGAATGGCCGTTTGAAGGTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198505.2-2008s1c1
Sequence:CCGGCTTTCAGAAGTCGAGCACTTACTCGAGTAAGTGCTCGACTTCTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198505
ATP13A5 MISSION shRNA Lentiviral Transduction Particles
ATPase type 13A5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198505.2-1918s1c1
Sequence:CCGGCCCAAGAATTTCCCACAGGAACTCGAGTTCCTGTGGGAAATTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198505.2-3326s1c1
Sequence:CCGGCCATAACATCGTGGAGGGTTTCTCGAGAAACCCTCCACGATGTTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198505.2-1435s1c1
Sequence:CCGGCAAATAAACCTCGTGTGCTTTCTCGAGAAAGCACACGAGGTTTATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198505.2-2161s1c1
Sequence:CCGGGATAACCTTCAAACGGCCATTCTCGAGAATGGCCGTTTGAAGGTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198505.2-2008s1c1
Sequence:CCGGCTTTCAGAAGTCGAGCACTTACTCGAGTAAGTGCTCGACTTCTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)