EMAIL THIS PAGE TO A FRIEND

ATP1A1

ATPase, Na+/K+ transporting, alpha 1 polypeptide

Gene ID:
Human(476) Summary: The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Mouse(11928) ATPase, Na+/K+ transporting, alpha 1 polypeptide
Rat(24211) ATPase, Na+/K+ transporting, alpha 1 polypeptide
chicken(396530) ATPase, Na+/K+ transporting, alpha 1 polypeptide
cow(282144) ATPase, Na+/K+ transporting, alpha 1 polypeptide
Horse(100034139) ATPase, Na+/K+ transporting, alpha 1 polypeptide
domestic cat(101083695) ATPase, Na+/K+ transporting, alpha 1 polypeptide
dog(403992) ATPase, Na+/K+ transporting, alpha 1 polypeptide
sheep(443381) ATPase, Na+/K+ transporting, alpha 1 polypeptide
Domestic Rabbit(100302415) ATPase, Na+/K+ transporting, alpha 1 polypeptide
naked mole-rat(101697634) ATPase, Na+/K+ transporting, alpha 1 polypeptide
domestic guinea pig(100192382) ATPase, Na+/K+ transporting, alpha 1 polypeptide
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501975 Anti-ATP1 α, N-Terminal antibody produced in rabbit affinity isolated antibody rat
immunofluorescence, western blot pricing
SAB4501974 Anti-ATPASE, N-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4301548 Anti-phospho-ATP1 α1/Na+K+ (pSer23) antibody produced in rabbit affinity isolated antibody rat
western blot pricing
SAB4504275 Anti-phospho-ATP1 α1/Na+K+ ATPase1 (pSer23) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4503897 Anti-phospho-ATPase (pSer16) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4301436 Anti-phospho-ATPase (pSer16) antibody produced in rabbit affinity isolated antibody human
western blot pricing
A276 Monoclonal Anti-Na+/K+ ATPase (α Subunit) antibody produced in mouse clone M7-PB-E9, ascites fluid canine, sheep, bovine, chicken, pig, mouse, human
ELISA, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
A275 Monoclonal Anti-Na+/K+ ATPase (α1 Subunit) antibody produced in mouse clone 9A-5, ascites fluid canine, rat, avian, human
ELISA, immunohistochemistry pricing
A277 Monoclonal Anti-Na+/K+ ATPase (α1 Subunit) antibody produced in mouse clone M8-P1-A3, ascites fluid sheep, canine, pig, rat
immunohistochemistry, western blot pricing

Small Molecule - Activator

Product # Description Species Add to Cart
 
D6003 Digoxin analytical standard human, mouse, rat pricing
D6770 Digoxin analytical standard human, mouse, rat pricing
D9404 Digitoxigenin rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
M4171 Melittin ≥97% (HPLC), synthetic human, mouse, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0295 AQUA Peptide SPDFTNENPLET[R] African clawed frog, cow, dog, human, mouse, pig, rat, sheep pricing
AQ0294 AQUA Peptide LNIPVNQVNP[R] African clawed frog, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000701 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144900 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144900 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144900 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000701 Rosetta Predictions human pricing
NM_001001586 Rosetta Predictions human pricing
NM_012504 Rosetta Predictions rat pricing
NM_144900 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186889 predicted 1704
2 SASI_Hs01_00186890 predicted 833
3 SASI_Hs01_00186891 predicted 3285
4 SASI_Hs01_00186892 predicted 1752
5 SASI_Hs01_00186894 predicted 1901
6 SASI_Hs02_00303102 predicted 1976
7 SASI_Hs01_00186895 predicted 1760
8 SASI_Hs01_00186896 predicted 1960
9 SASI_Hs02_00303103 predicted 697
10 SASI_Hs02_00303104 predicted 832
11 SASI_Hs01_00186887 predicted 1900
12 SASI_Hs01_00186888 predicted 807
13 SASI_Hs01_00186893 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140139 predicted 1701
2 SASI_Hs01_00140140 predicted 827
3 SASI_Hs01_00140141 predicted 1755
4 SASI_Hs01_00140143 predicted 1903
5 SASI_Hs02_00303847 predicted 1976
6 SASI_Hs01_00140144 predicted 1762
7 SASI_Hs01_00140145 predicted 1968
8 SASI_Hs01_00140146 predicted 697
9 SASI_Hs02_00303848 predicted 827
10 SASI_Hs01_00140137 predicted 1891
11 SASI_Hs01_00140138 predicted 810
12 SASI_Hs01_00140142 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042689 predicted 1500
2 SASI_Rn01_00042690 predicted 2526
3 SASI_Rn01_00042691 predicted 2290
4 SASI_Rn01_00042692 predicted 352
5 SASI_Rn01_00042693 predicted 2159
6 SASI_Rn01_00042694 predicted 608
7 SASI_Rn01_00042695 predicted 1512
8 SASI_Rn01_00042697 predicted 2848
9 SASI_Rn01_00042698 predicted 435
10 SASI_Rn02_00259557 predicted 751
11 SASI_Rn01_00042696 predicted 2659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144900 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340360 predicted 3104
2 SASI_Mm01_00035905 predicted 1610
3 SASI_Mm01_00035906 predicted 334
4 SASI_Mm01_00035907 predicted 1518
5 SASI_Mm02_00340361 predicted 1172
6 SASI_Mm01_00035909 predicted 360
7 SASI_Mm01_00035911 predicted 1527
8 SASI_Mm01_00035912 predicted 3067
9 SASI_Mm01_00035913 predicted 2173
10 SASI_Mm01_00035914 predicted 2578
11 SASI_Mm01_00035908 predicted 2793
12 SASI_Mm01_00035910 predicted 2860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000701
VALIDATED
ATP1A1 MISSION shRNA Bacterial Glycerol Stock
ATPase, Na+/K+ transporting, alpha 1 polypeptide
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_000701.5-1716s1c1
Sequence:CCGGCCAGTTGTCTATTCATAAGAACTCGAGTTCTTATGAATAGACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000701.5-2616s1c1
Sequence:CCGGCCCGTTCCTGATATTTATTATCTCGAGATAATAAATATCAGGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_000701.5-850s1c1
Sequence:CCGGCCTGCTGACCTCAGAATCATACTCGAGTATGATTCTGAGGTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_000701.5-2250s1c1
Sequence:CCGGCGGCAGTGATCTAAAGGACATCTCGAGATGTCCTTTAGATCACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000701.5-392s1c1
Sequence:CCGGGCCTTGATGAACTTCATCGTACTCGAGTACGATGAAGTTCATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000701.7-3546s21c1
Sequence:CCGGGACGTCCTGGAATGAAGCATGCTCGAGCATGCTTCATTCCAGGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-1948s21c1
Sequence:CCGGGCCTTTCAGAACGCCTATTTGCTCGAGCAAATAGGCGTTCTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000701.7-3501s21c1
Sequence:CCGGGAACTCTACCCTGGTAGGAAACTCGAGTTTCCTACCAGGGTAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-2672s21c1
Sequence:CCGGATACCTTAACCAGTAACATTCCTCGAGGAATGTTACTGGTTAAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-841s21c1
Sequence:CCGGCAAGCCCTTGTGATTCGAAATCTCGAGATTTCGAATCACAAGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000701.7-3478s21c1
Sequence:CCGGGTGTACTTCAGTCTTGGAGTTCTCGAGAACTCCAAGACTGAAGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-2065s21c1
Sequence:CCGGGTGAATTTCCCTATCGATAATCTCGAGATTATCGATAGGGAAATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-741s21c1
Sequence:CCGGGGTGCTATCAGCCGTTGTAATCTCGAGATTACAACGGCTGATAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-1359s21c1
Sequence:CCGGCACGGTCTGTCTGACACTTACCTCGAGGTAAGTGTCAGACAGACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000701
VALIDATED
ATP1A1 MISSION shRNA shRNA Plasmid DNA
ATPase, Na+/K+ transporting, alpha 1 polypeptide
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_000701.5-1716s1c1
Sequence:CCGGCCAGTTGTCTATTCATAAGAACTCGAGTTCTTATGAATAGACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000701.5-2616s1c1
Sequence:CCGGCCCGTTCCTGATATTTATTATCTCGAGATAATAAATATCAGGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_000701.5-850s1c1
Sequence:CCGGCCTGCTGACCTCAGAATCATACTCGAGTATGATTCTGAGGTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_000701.5-2250s1c1
Sequence:CCGGCGGCAGTGATCTAAAGGACATCTCGAGATGTCCTTTAGATCACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000701.5-392s1c1
Sequence:CCGGGCCTTGATGAACTTCATCGTACTCGAGTACGATGAAGTTCATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000701.7-3546s21c1
Sequence:CCGGGACGTCCTGGAATGAAGCATGCTCGAGCATGCTTCATTCCAGGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-1948s21c1
Sequence:CCGGGCCTTTCAGAACGCCTATTTGCTCGAGCAAATAGGCGTTCTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000701.7-3501s21c1
Sequence:CCGGGAACTCTACCCTGGTAGGAAACTCGAGTTTCCTACCAGGGTAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-2672s21c1
Sequence:CCGGATACCTTAACCAGTAACATTCCTCGAGGAATGTTACTGGTTAAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-841s21c1
Sequence:CCGGCAAGCCCTTGTGATTCGAAATCTCGAGATTTCGAATCACAAGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000701.7-3478s21c1
Sequence:CCGGGTGTACTTCAGTCTTGGAGTTCTCGAGAACTCCAAGACTGAAGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-2065s21c1
Sequence:CCGGGTGAATTTCCCTATCGATAATCTCGAGATTATCGATAGGGAAATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-741s21c1
Sequence:CCGGGGTGCTATCAGCCGTTGTAATCTCGAGATTACAACGGCTGATAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-1359s21c1
Sequence:CCGGCACGGTCTGTCTGACACTTACCTCGAGGTAAGTGTCAGACAGACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000701
VALIDATED
ATP1A1 MISSION shRNA Lentiviral Transduction Particles
ATPase, Na+/K+ transporting, alpha 1 polypeptide
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_000701.5-1716s1c1
Sequence:CCGGCCAGTTGTCTATTCATAAGAACTCGAGTTCTTATGAATAGACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000701.5-2616s1c1
Sequence:CCGGCCCGTTCCTGATATTTATTATCTCGAGATAATAAATATCAGGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_000701.5-850s1c1
Sequence:CCGGCCTGCTGACCTCAGAATCATACTCGAGTATGATTCTGAGGTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_000701.5-2250s1c1
Sequence:CCGGCGGCAGTGATCTAAAGGACATCTCGAGATGTCCTTTAGATCACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000701.5-392s1c1
Sequence:CCGGGCCTTGATGAACTTCATCGTACTCGAGTACGATGAAGTTCATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000701.7-3546s21c1
Sequence:CCGGGACGTCCTGGAATGAAGCATGCTCGAGCATGCTTCATTCCAGGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-1948s21c1
Sequence:CCGGGCCTTTCAGAACGCCTATTTGCTCGAGCAAATAGGCGTTCTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000701.7-3501s21c1
Sequence:CCGGGAACTCTACCCTGGTAGGAAACTCGAGTTTCCTACCAGGGTAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-2672s21c1
Sequence:CCGGATACCTTAACCAGTAACATTCCTCGAGGAATGTTACTGGTTAAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-841s21c1
Sequence:CCGGCAAGCCCTTGTGATTCGAAATCTCGAGATTTCGAATCACAAGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000701.7-3478s21c1
Sequence:CCGGGTGTACTTCAGTCTTGGAGTTCTCGAGAACTCCAAGACTGAAGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-2065s21c1
Sequence:CCGGGTGAATTTCCCTATCGATAATCTCGAGATTATCGATAGGGAAATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-741s21c1
Sequence:CCGGGGTGCTATCAGCCGTTGTAATCTCGAGATTACAACGGCTGATAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000701.7-1359s21c1
Sequence:CCGGCACGGTCTGTCTGACACTTACCTCGAGGTAAGTGTCAGACAGACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144900
VALIDATED
ATP1A1 MISSION shRNA Bacterial Glycerol Stock
ATPase, Na+/K+ transporting, alpha 1 polypeptide
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144900.1-3458s1c1
Sequence:CCGGCGTCCTGGAATGAAGCATGTACTCGAGTACATGCTTCATTCCAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144900.1-364s1c1
Sequence:CCGGGAAGTGTCTATGGACGACCATCTCGAGATGGTCGTCCATAGACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144900.1-1615s1c1
Sequence:CCGGGCGCTCTTAAAGTGCATTGAACTCGAGTTCAATGCACTTTAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144900.1-936s1c1
Sequence:CCGGCCCGGATTTCACAAACGAGAACTCGAGTTCTCGTTTGTGAAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144900.1-406s1c1
Sequence:CCGGCATCGTAAATACGGAACAGATCTCGAGATCTGTTCCGTATTTACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144900.1-3458s21c1
Sequence:CCGGCGTCCTGGAATGAAGCATGTACTCGAGTACATGCTTCATTCCAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144900.1-936s21c1
Sequence:CCGGCCCGGATTTCACAAACGAGAACTCGAGTTCTCGTTTGTGAAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144900.1-364s21c1
Sequence:CCGGGAAGTGTCTATGGACGACCATCTCGAGATGGTCGTCCATAGACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144900.1-2593s21c1
Sequence:CCGGACCAGTAACATTCCGGAAATCCTCGAGGATTTCCGGAATGTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144900.1-754s21c1
Sequence:CCGGCAAGCCCTTGTGATTCGAAATCTCGAGATTTCGAATCACAAGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144900
VALIDATED
ATP1A1 MISSION shRNA shRNA Plasmid DNA
ATPase, Na+/K+ transporting, alpha 1 polypeptide
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144900.1-3458s1c1
Sequence:CCGGCGTCCTGGAATGAAGCATGTACTCGAGTACATGCTTCATTCCAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144900.1-364s1c1
Sequence:CCGGGAAGTGTCTATGGACGACCATCTCGAGATGGTCGTCCATAGACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144900.1-1615s1c1
Sequence:CCGGGCGCTCTTAAAGTGCATTGAACTCGAGTTCAATGCACTTTAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144900.1-936s1c1
Sequence:CCGGCCCGGATTTCACAAACGAGAACTCGAGTTCTCGTTTGTGAAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144900.1-406s1c1
Sequence:CCGGCATCGTAAATACGGAACAGATCTCGAGATCTGTTCCGTATTTACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144900.1-3458s21c1
Sequence:CCGGCGTCCTGGAATGAAGCATGTACTCGAGTACATGCTTCATTCCAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144900.1-936s21c1
Sequence:CCGGCCCGGATTTCACAAACGAGAACTCGAGTTCTCGTTTGTGAAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144900.1-364s21c1
Sequence:CCGGGAAGTGTCTATGGACGACCATCTCGAGATGGTCGTCCATAGACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144900.1-2593s21c1
Sequence:CCGGACCAGTAACATTCCGGAAATCCTCGAGGATTTCCGGAATGTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144900.1-754s21c1
Sequence:CCGGCAAGCCCTTGTGATTCGAAATCTCGAGATTTCGAATCACAAGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144900
VALIDATED
ATP1A1 MISSION shRNA Lentiviral Transduction Particles
ATPase, Na+/K+ transporting, alpha 1 polypeptide
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144900.1-3458s1c1
Sequence:CCGGCGTCCTGGAATGAAGCATGTACTCGAGTACATGCTTCATTCCAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144900.1-364s1c1
Sequence:CCGGGAAGTGTCTATGGACGACCATCTCGAGATGGTCGTCCATAGACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144900.1-1615s1c1
Sequence:CCGGGCGCTCTTAAAGTGCATTGAACTCGAGTTCAATGCACTTTAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144900.1-936s1c1
Sequence:CCGGCCCGGATTTCACAAACGAGAACTCGAGTTCTCGTTTGTGAAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144900.1-406s1c1
Sequence:CCGGCATCGTAAATACGGAACAGATCTCGAGATCTGTTCCGTATTTACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144900.1-3458s21c1
Sequence:CCGGCGTCCTGGAATGAAGCATGTACTCGAGTACATGCTTCATTCCAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144900.1-936s21c1
Sequence:CCGGCCCGGATTTCACAAACGAGAACTCGAGTTCTCGTTTGTGAAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144900.1-364s21c1
Sequence:CCGGGAAGTGTCTATGGACGACCATCTCGAGATGGTCGTCCATAGACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144900.1-2593s21c1
Sequence:CCGGACCAGTAACATTCCGGAAATCCTCGAGGATTTCCGGAATGTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144900.1-754s21c1
Sequence:CCGGCAAGCCCTTGTGATTCGAAATCTCGAGATTTCGAATCACAAGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks